Transcript: Human NM_001286694.1

Homo sapiens calmodulin like 4 (CALML4), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
CALML4 (91860)
Length:
4624
CDS:
932..1294

Additional Resources:

NCBI RefSeq record:
NM_001286694.1
NBCI Gene record:
CALML4 (91860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370869 AGACAACATTACCCAACTATA pLKO_005 1399 3UTR 100% 13.200 18.480 N CALML4 n/a
2 TRCN0000365583 CATGGTATGAGTAGATCTTTA pLKO_005 1460 3UTR 100% 13.200 18.480 N CALML4 n/a
3 TRCN0000365650 ACCCACGGGATAGACGGAAAT pLKO_005 995 CDS 100% 10.800 15.120 N CALML4 n/a
4 TRCN0000053533 GAAGCAGATATCGAACCCAAT pLKO.1 1214 CDS 100% 4.050 5.670 N CALML4 n/a
5 TRCN0000053536 GATATCGAACCCAATGGCAAA pLKO.1 1220 CDS 100% 4.050 5.670 N CALML4 n/a
6 TRCN0000053535 GAAAGGGAACTGAACGCGGTT pLKO.1 802 5UTR 100% 2.160 3.024 N CALML4 n/a
7 TRCN0000365582 CCATTATGCACATGCAAATAA pLKO_005 1044 CDS 100% 15.000 10.500 N CALML4 n/a
8 TRCN0000370868 AGGAATGCTTCTCCCTGTATG pLKO_005 873 5UTR 100% 10.800 7.560 N CALML4 n/a
9 TRCN0000053537 CAGCTTGGCAGACTTTAGACT pLKO.1 770 5UTR 100% 3.000 2.100 N CALML4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12970 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12970 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466757 GGTTTTCACAATCCACCCCTAGAG pLX_317 100% 100% 100% V5 n/a
Download CSV