Transcript: Human NM_001286723.1

Homo sapiens family with sequence similarity 120A (FAM120A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FAM120A (23196)
Length:
2418
CDS:
221..2176

Additional Resources:

NCBI RefSeq record:
NM_001286723.1
NBCI Gene record:
FAM120A (23196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346070 ATAGGCCAGTTCGTCAGTATG pLKO_005 2025 CDS 100% 10.800 15.120 N Fam120a n/a
2 TRCN0000074921 GCTTCCTTTCACTGGAGTTTA pLKO.1 971 CDS 100% 13.200 9.240 N FAM120A n/a
3 TRCN0000074920 GCTGACTATGTACGCAACATT pLKO.1 1079 CDS 100% 5.625 3.938 N FAM120A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286723.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02734 pDONR223 100% 57.8% 56.9% None (many diffs) n/a
2 ccsbBroad304_02734 pLX_304 0% 57.8% 56.9% V5 (many diffs) n/a
3 TRCN0000480694 ATACAGGGTGCACGCCTTGCGCGT pLX_317 13.6% 57.8% 56.9% V5 (many diffs) n/a
4 ccsbBroadEn_07851 pDONR223 100% 57.7% 56.9% None (many diffs) n/a
5 ccsbBroad304_07851 pLX_304 0% 57.7% 56.9% V5 (many diffs) n/a
6 TRCN0000476487 TTGCCACTAGACTTATAACTTATA pLX_317 9.1% 57.7% 56.9% V5 (many diffs) n/a
Download CSV