Transcript: Mouse NM_001287139.1

Mus musculus zinc finger, ZZ domain containing 3 (Zzz3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Zzz3 (108946)
Length:
7546
CDS:
389..3118

Additional Resources:

NCBI RefSeq record:
NM_001287139.1
NBCI Gene record:
Zzz3 (108946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001287139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336316 TACCTGTGGAACGACGAAATC pLKO_005 1269 CDS 100% 0.000 0.000 N Zzz3 n/a
2 TRCN0000336254 TTGTAGGTGGTGGTGTTAAAT pLKO_005 3331 3UTR 100% 15.000 10.500 N Zzz3 n/a
3 TRCN0000194364 CAGGCAGAACACCTAACTTAT pLKO.1 2547 CDS 100% 13.200 9.240 N Zzz3 n/a
4 TRCN0000353323 CAGGCAGAACACCTAACTTAT pLKO_005 2547 CDS 100% 13.200 9.240 N Zzz3 n/a
5 TRCN0000336315 TTCCCGATCTACTCGTGTTAC pLKO_005 418 CDS 100% 10.800 7.560 N Zzz3 n/a
6 TRCN0000370301 TTCCCGATCTACTCGTGTTAC pLKO_005 418 CDS 100% 10.800 7.560 N ZZZ3 n/a
7 TRCN0000193117 CCAGAGTGAATATTGGACATT pLKO.1 1785 CDS 100% 4.950 3.465 N Zzz3 n/a
8 TRCN0000176316 CCTATTGGATTTGTGGAGAAA pLKO.1 2021 CDS 100% 4.950 3.465 N Zzz3 n/a
9 TRCN0000193719 CCTCTTTAAACCTTCCACTTT pLKO.1 2623 CDS 100% 4.950 3.465 N Zzz3 n/a
10 TRCN0000353324 AGTGAGGAAGGGCCACTTAAT pLKO_005 956 CDS 100% 13.200 7.920 N Zzz3 n/a
11 TRCN0000376637 AGTGAGGAAGGGCCACTTAAT pLKO_005 956 CDS 100% 13.200 7.920 N ZZZ3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287139.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14102 pDONR223 100% 39.7% 41.2% None (many diffs) n/a
2 ccsbBroad304_14102 pLX_304 0% 39.7% 41.2% V5 (many diffs) n/a
3 TRCN0000467796 CCCCAAGCTGACCCAAAACTTGAA pLX_317 32.1% 39.7% 41.2% V5 (many diffs) n/a
Download CSV