Transcript: Human NM_001287596.2

Homo sapiens solute carrier family 1 member 7 (SLC1A7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
SLC1A7 (6512)
Length:
1327
CDS:
190..666

Additional Resources:

NCBI RefSeq record:
NM_001287596.2
NBCI Gene record:
SLC1A7 (6512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043430 GCCTCTCACCACAGGAAATTA pLKO.1 311 CDS 100% 15.000 10.500 N SLC1A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287596.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15592 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15592 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466362 CTCCACGGCACCAAGATTTTCTAG pLX_317 63.9% 100% 100% V5 n/a
4 TRCN0000491540 CCAAGTATGCTATACAATTACTCC pLX_317 63.4% 100% 100% V5 (not translated due to prior stop codon) n/a
5 ccsbBroadEn_06958 pDONR223 100% 27.6% 26.4% None (many diffs) n/a
6 ccsbBroad304_06958 pLX_304 0% 27.6% 26.4% V5 (many diffs) n/a
7 TRCN0000472841 CTACTTATCCTGAACTACCACGTC pLX_317 29.8% 27.6% 26.4% V5 (many diffs) n/a
Download CSV