Transcript: Human NM_001287760.1

Homo sapiens collagen type IV alpha 6 chain (COL4A6), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
COL4A6 (1288)
Length:
6552
CDS:
235..5136

Additional Resources:

NCBI RefSeq record:
NM_001287760.1
NBCI Gene record:
COL4A6 (1288)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294314 CTATGCCAGGCGCAATGATAA pLKO_005 4662 CDS 100% 13.200 18.480 N COL4A6 n/a
2 TRCN0000294315 ATGGACTAATAGGCAATATAG pLKO_005 3527 CDS 100% 13.200 9.240 N COL4A6 n/a
3 TRCN0000084133 GCCAAGCCTATCAAAGGAAAT pLKO.1 5895 3UTR 100% 10.800 7.560 N COL4A6 n/a
4 TRCN0000286963 GCCAAGCCTATCAAAGGAAAT pLKO_005 5895 3UTR 100% 10.800 7.560 N COL4A6 n/a
5 TRCN0000084136 CCTGTGTCTGAAACGCTGAAA pLKO.1 5059 CDS 100% 4.950 3.465 N COL4A6 n/a
6 TRCN0000287028 CCTGTGTCTGAAACGCTGAAA pLKO_005 5059 CDS 100% 4.950 3.465 N COL4A6 n/a
7 TRCN0000084135 CCTGTATTATTCCTGGGTCAT pLKO.1 2198 CDS 100% 4.050 2.835 N COL4A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287760.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10740 pDONR223 100% 3.8% 2.8% None (many diffs) n/a
2 ccsbBroad304_10740 pLX_304 0% 3.8% 2.8% V5 (many diffs) n/a
3 TRCN0000478194 TCTCGTTCCTTCGAGATGCCTAAG pLX_317 100% 3.8% 2.8% V5 (many diffs) n/a
Download CSV