Transcript: Human NM_001287811.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member C16 (DNAJC16), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
DNAJC16 (23341)
Length:
5893
CDS:
916..2328

Additional Resources:

NCBI RefSeq record:
NM_001287811.1
NBCI Gene record:
DNAJC16 (23341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294366 ATCTCGACCAGCTGCGTAAAG pLKO_005 1421 CDS 100% 10.800 15.120 N DNAJC16 n/a
2 TRCN0000064149 GCTTACGAGATTCTTTCAAAT pLKO.1 205 5UTR 100% 13.200 10.560 N DNAJC16 n/a
3 TRCN0000291560 GCTTACGAGATTCTTTCAAAT pLKO_005 205 5UTR 100% 13.200 10.560 N DNAJC16 n/a
4 TRCN0000294309 CCTCTATCCTAGGAATCATTA pLKO_005 626 5UTR 100% 13.200 9.240 N DNAJC16 n/a
5 TRCN0000294364 AGCGTGACTACACTGGTTATG pLKO_005 2051 CDS 100% 10.800 7.560 N DNAJC16 n/a
6 TRCN0000064152 GCAGAAGACAAGTTCATTCAA pLKO.1 175 5UTR 100% 5.625 3.938 N DNAJC16 n/a
7 TRCN0000298265 GCAGAAGACAAGTTCATTCAA pLKO_005 175 5UTR 100% 5.625 3.938 N DNAJC16 n/a
8 TRCN0000064150 CCCGAGGTATGAAGAAGCAAA pLKO.1 1004 CDS 100% 4.950 3.465 N DNAJC16 n/a
9 TRCN0000064148 GCCTTTGCATACAAAGATTAT pLKO.1 850 5UTR 100% 1.320 0.924 N DNAJC16 n/a
10 TRCN0000298267 GCCTTTGCATACAAAGATTAT pLKO_005 850 5UTR 100% 1.320 0.924 N DNAJC16 n/a
11 TRCN0000064151 CCACATGAATGTGGTCCTCAT pLKO.1 1842 CDS 100% 0.405 0.284 N DNAJC16 n/a
12 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 3884 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287811.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02754 pDONR223 100% 60.1% 60.1% None 0_1ins936 n/a
2 ccsbBroad304_02754 pLX_304 0% 60.1% 60.1% V5 0_1ins936 n/a
Download CSV