Transcript: Human NM_001288953.2

Homo sapiens tetratricopeptide repeat domain 7A (TTC7A), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
TTC7A (57217)
Length:
5399
CDS:
725..3199

Additional Resources:

NCBI RefSeq record:
NM_001288953.2
NBCI Gene record:
TTC7A (57217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131173 GCAAGATGAATTGCACCGGAA pLKO.1 2149 CDS 100% 2.160 3.024 N TTC7A n/a
2 TRCN0000128934 CCAAAGCAACTCAGAACTTCA pLKO.1 1440 CDS 100% 4.950 3.465 N TTC7A n/a
3 TRCN0000128543 CGTTTGGAGAATTTCACCTTT pLKO.1 1851 CDS 100% 4.950 3.465 N TTC7A n/a
4 TRCN0000129208 CTGAAGTCCAAGCAAGATGAA pLKO.1 2138 CDS 100% 4.950 3.465 N TTC7A n/a
5 TRCN0000129572 CGAGCCATGAAGTTTGCGTTT pLKO.1 1835 CDS 100% 4.050 2.835 N TTC7A n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 784 CDS 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 784 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288953.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12338 pDONR223 100% 61.1% 61% None 1_960del;1691A>G n/a
2 ccsbBroad304_12338 pLX_304 0% 61.1% 61% V5 1_960del;1691A>G n/a
3 TRCN0000480913 CCACGCTACAAGCTGTTAGGAAGT pLX_317 26.4% 61.1% 61% V5 1_960del;1691A>G n/a
Download CSV