Transcript: Human NM_001289158.1

Homo sapiens adhesion G protein-coupled receptor E3 (ADGRE3), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
ADGRE3 (84658)
Length:
2267
CDS:
149..1951

Additional Resources:

NCBI RefSeq record:
NM_001289158.1
NBCI Gene record:
ADGRE3 (84658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356972 ATTCAACTTGAACGTCCAAAT pLKO_005 619 CDS 100% 10.800 15.120 N ADGRE3 n/a
2 TRCN0000356970 GTGGTTTAGAGAGATCGTAAA pLKO_005 1825 CDS 100% 10.800 15.120 N ADGRE3 n/a
3 TRCN0000008246 CGTGAACAAGAGTCACACCAT pLKO.1 967 CDS 100% 2.640 3.696 N ADGRE3 n/a
4 TRCN0000356973 CACCTGCAACCATGGATATAC pLKO_005 277 CDS 100% 13.200 9.240 N ADGRE3 n/a
5 TRCN0000008243 CATGGATCTCTTTGGCATTAT pLKO.1 1988 3UTR 100% 13.200 9.240 N ADGRE3 n/a
6 TRCN0000008247 CTGGGCAGAAACTATTCACAT pLKO.1 306 CDS 100% 4.950 3.465 N ADGRE3 n/a
7 TRCN0000008244 CCAGGGATTCATGTGGAGTTT pLKO.1 1495 CDS 100% 4.950 2.970 N ADGRE3 n/a
8 TRCN0000008245 CCAAATGAACTCAATGGACAT pLKO.1 634 CDS 100% 4.050 2.430 N ADGRE3 n/a
9 TRCN0000221170 GCTGACTGTCATCACCTACAT pLKO.1 1057 CDS 100% 4.950 2.475 Y ADGRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289158.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488159 AAAGAGACGACCAAAAGTACATGC pLX_317 18.3% 91.9% 91.8% V5 (not translated due to prior stop codon) 198_199ins156;998G>A n/a
2 TRCN0000491459 AAAGGTGTCCGTACCCTGTTCCGA pLX_317 19% 91.9% 91.7% V5 198_199ins156;998G>A;1800_1801insG n/a
Download CSV