Transcript: Mouse NM_001289463.1

Mus musculus membrane metallo endopeptidase (Mme), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-15
Taxon:
Mus musculus (mouse)
Gene:
Mme (17380)
Length:
5872
CDS:
239..2491

Additional Resources:

NCBI RefSeq record:
NM_001289463.1
NBCI Gene record:
Mme (17380)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031167 CGGTGTGCTAACTACGTCAAT pLKO.1 1466 CDS 100% 4.950 6.930 N Mme n/a
2 TRCN0000031166 GCAACCTATGATGATGGCATT pLKO.1 386 CDS 100% 4.050 5.670 N Mme n/a
3 TRCN0000031164 CCCACATCAATTTAGTTTGAA pLKO.1 3015 3UTR 100% 5.625 4.500 N Mme n/a
4 TRCN0000413353 TCAAACTGTTACCAGATATAT pLKO_005 711 CDS 100% 15.000 10.500 N Mme n/a
5 TRCN0000414362 AGTCATTCAGCTGGTCAAATT pLKO_005 1194 CDS 100% 13.200 9.240 N Mme n/a
6 TRCN0000420993 TAATGTCCTGGAGGTTCATAA pLKO_005 1347 CDS 100% 13.200 9.240 N Mme n/a
7 TRCN0000031165 GCATGGTCATTGGACATGAAA pLKO.1 1974 CDS 100% 5.625 3.938 N Mme n/a
8 TRCN0000031168 GCCTTTCATTGCCGCAAGAAT pLKO.1 2432 CDS 100% 5.625 3.938 N Mme n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289463.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01020 pDONR223 100% 90.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_01020 pLX_304 0% 90.9% 94.1% V5 (many diffs) n/a
3 TRCN0000475807 TGAGCATTCACCCTCACACGGAAA pLX_317 12% 90.9% 94.1% V5 (many diffs) n/a
Download CSV