Transcript: Mouse NM_001289473.1

Mus musculus Erbb2 interacting protein (Erbin), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Erbin (59079)
Length:
6530
CDS:
399..4607

Additional Resources:

NCBI RefSeq record:
NM_001289473.1
NBCI Gene record:
Erbin (59079)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313911 GAGTGCCCGTCCCTCTATTAA pLKO_005 3803 CDS 100% 15.000 21.000 N Erbin n/a
2 TRCN0000109431 GCCGGAAACTATTGGTTCATT pLKO.1 1202 CDS 100% 5.625 7.875 N Erbin n/a
3 TRCN0000317493 GCCGGAAACTATTGGTTCATT pLKO_005 1202 CDS 100% 5.625 7.875 N Erbin n/a
4 TRCN0000109433 GCAGACTCTTTATCCGATGAA pLKO.1 2307 CDS 100% 4.950 6.930 N Erbin n/a
5 TRCN0000109434 CCAGACTCAATAGGAGGGTTA pLKO.1 1272 CDS 100% 4.050 5.670 N Erbin n/a
6 TRCN0000313980 CAGTCACTACTCTAGATTATT pLKO_005 466 CDS 100% 15.000 12.000 N Erbin n/a
7 TRCN0000109432 GCCTTTGAGTAATGGACAAAT pLKO.1 4127 CDS 100% 13.200 10.560 N Erbin n/a
8 TRCN0000109430 CGCTCCATCATAATCTAATTT pLKO.1 5461 3UTR 100% 15.000 10.500 N Erbin n/a
9 TRCN0000313972 GTTGGATTCAAATCAGATAAA pLKO_005 4797 3UTR 100% 13.200 9.240 N Erbin n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08611 pDONR223 100% 85.5% 86.8% None (many diffs) n/a
2 TRCN0000472299 ATATAGGGACACAAAAATCGTTTA pLX_317 5.5% 85.5% 86.8% V5 (many diffs) n/a
3 ccsbBroad304_08611 pLX_304 12.4% 85.5% 76.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV