Transcript: Mouse NM_001289498.1

Mus musculus EGF-like, fibronectin type III and laminin G domains (Egflam), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Egflam (268780)
Length:
4883
CDS:
752..3355

Additional Resources:

NCBI RefSeq record:
NM_001289498.1
NBCI Gene record:
Egflam (268780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094132 CTGACGTATGACAACCCAAAT pLKO.1 2837 CDS 100% 10.800 8.640 N Egflam n/a
2 TRCN0000094133 CGTAACCTTTGAGCCTCTGAA pLKO.1 1489 CDS 100% 4.950 3.960 N Egflam n/a
3 TRCN0000094130 CCAGATACCAACTACCAGTTT pLKO.1 923 CDS 100% 4.950 3.465 N Egflam n/a
4 TRCN0000094129 CCTGAACTTCATACTTCCAAT pLKO.1 3837 3UTR 100% 4.950 3.465 N Egflam n/a
5 TRCN0000094131 CCTGACGTATGACAACCCAAA pLKO.1 2836 CDS 100% 4.050 2.835 N Egflam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09549 pDONR223 100% 72% 73% None (many diffs) n/a
2 ccsbBroad304_09549 pLX_304 0% 72% 73% V5 (many diffs) n/a
3 TRCN0000467181 CGAGCTCGCTCGCCCCCGGCTCCG pLX_317 11.6% 72% 73% V5 (many diffs) n/a
Download CSV