Transcript: Mouse NM_001289762.1

Mus musculus retinoic acid receptor, beta (Rarb), transcript variant beta4, mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Rarb (218772)
Length:
2687
CDS:
256..1455

Additional Resources:

NCBI RefSeq record:
NM_001289762.1
NBCI Gene record:
Rarb (218772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222397 CGAGATAAGAACTGCGTCATT pLKO.1 463 CDS 100% 4.950 6.930 N Rarb n/a
2 TRCN0000222399 CGAACGTGTAATTACCTTGAA pLKO.1 1263 CDS 100% 4.950 3.960 N Rarb n/a
3 TRCN0000222400 CCAAGTTCAAGTGGGAATATA pLKO.1 1360 CDS 100% 15.000 10.500 N Rarb n/a
4 TRCN0000222396 CCGCAGAAGTATTCAGAAGAA pLKO.1 423 CDS 100% 4.950 3.465 N Rarb n/a
5 TRCN0000021195 CTGGGTAAATACACCACGAAT pLKO.1 700 CDS 100% 4.950 3.465 N RARB n/a
6 TRCN0000222398 GCATGTCCAAAGAGTCTGTTA pLKO.1 542 CDS 100% 4.950 3.465 N Rarb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01376 pDONR223 100% 80.9% 87.2% None (many diffs) n/a
2 ccsbBroad304_01376 pLX_304 0% 80.9% 87.2% V5 (many diffs) n/a
3 TRCN0000469377 CGCATTGTATTTCGACTGGATGGT pLX_317 34% 80.9% 87.2% V5 (many diffs) n/a
4 TRCN0000488589 TGGGTCACGGCAGAAACTACTCCC pLX_317 16.4% 80.9% 87% V5 (many diffs) n/a
Download CSV