Construct: ORF TRCN0000488589
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019946.1_s317c1
- DNA Barcode:
- TGGGTCACGGCAGAAACTACTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RARB (5915)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488589
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5915 | RARB | retinoic acid receptor beta | NM_000965.4 | 99.9% | 99.7% | 1344_1345insG |
| 2 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290216.2 | 90.5% | 84.6% | (many diffs) |
| 3 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290277.1 | 89.6% | 89.5% | 785_786ins138;1206_1207insG |
| 4 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290300.1 | 89.4% | 88.1% | (many diffs) |
| 5 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290266.1 | 88.6% | 87.9% | (many diffs) |
| 6 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290217.1 | 74.9% | 74.8% | 0_1ins336;1008_1009insG |
| 7 | human | 5915 | RARB | retinoic acid receptor beta | NM_001290276.1 | 74.9% | 74.8% | 0_1ins336;1008_1009insG |
| 8 | human | 5915 | RARB | retinoic acid receptor beta | NM_016152.3 | 74.9% | 74.8% | 0_1ins336;1008_1009insG |
| 9 | human | 5915 | RARB | retinoic acid receptor beta | NR_110892.1 | 36.7% | 1_469del;917_918ins161;1653_3061delinsG | |
| 10 | human | 5915 | RARB | retinoic acid receptor beta | NR_110893.1 | 35.3% | 1_469del;1254_1255ins205;1609_3017delinsG | |
| 11 | mouse | 218772 | Rarb | retinoic acid receptor, beta | NM_011243.2 | 91% | 98.2% | (many diffs) |
| 12 | mouse | 218772 | Rarb | retinoic acid receptor, beta | NM_001289761.1 | 81.5% | 83.8% | (many diffs) |
| 13 | mouse | 218772 | Rarb | retinoic acid receptor, beta | NM_001289762.1 | 80.9% | 87% | (many diffs) |
| 14 | mouse | 218772 | Rarb | retinoic acid receptor, beta | NM_001289760.1 | 79.8% | 83.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1419
- ORF length:
- 1347
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtttgac tgtatggatg ttctgtcagt gagtcctggg caaatcctgg 121 atttctacac tgcgagtccg tcttcctgca tgctccagga gaaagctctc aaagcatgct 181 tcagtggatt gacccaaacc gaatggcagc atcggcacac tgctcaatca attgaaacac 241 agagcaccag ctctgaggaa ctcgtcccaa gccccccatc tccacttcct ccccctcgag 301 tgtacaaacc ctgcttcgtc tgccaggaca aatcatcagg gtaccactat ggggtcagcg 361 cctgtgaggg atgtaagggc tttttccgca gaagtattca gaagaatatg atttacactt 421 gtcaccgaga taagaactgt gttattaata aagtcaccag gaatcgatgc caatactgtc 481 gactccagaa gtgctttgaa gtgggaatgt ccaaagaatc tgtcaggaat gacaggaaca 541 agaaaaagaa ggagacttcg aagcaagaat gcacagagag ctatgaaatg acagctgagt 601 tggacgatct cacagagaag atccgaaaag ctcaccagga aactttccct tcactctgcc 661 agctgggtaa atacaccacg aattccagtg ctgaccatcg agtccgactg gacctgggcc 721 tctgggacaa attcagtgaa ctggccacca agtgcattat taagatcgtg gagtttgcta 781 aacgtctgcc tggtttcact ggcttgacca tcgcagacca aattaccctg ctgaaggccg 841 cctgcctgga catcctgatt cttagaattt gcaccaggta taccccagaa caagacacca 901 tgactttctc agacggcctt accctaaatc gaactcagat gcacaatgct ggatttggtc 961 ctctgactga ccttgtgttc acctttgcca accagctcct gcctttggaa atggatgaca 1021 cagaaacagg ccttctcagt gccatctgct taatctgtgg agaccgccag gaccttgagg 1081 aaccgacaaa agtagataag ctacaagaac cattgctgga agcactaaaa atttatatca 1141 gaaaaagacg acccagcaag cctcacatgt ttccaaagat cttaatgaaa atcacagatc 1201 TCCGTAGCAT CAGTGCTAAA GGTGCAGAGC GTGTAATTAC CTTGAAAATG GAAATTCCTG 1261 GATCAATGCC ACCTCTCATT CAAGAAATGC TGGAGAATTC TGAAGGACAT GAACCCTTGA 1321 CCCCAAGTTC AAGTGGGAAC ACAGCAGAGC ACAGTCCTAG CATCTCACCC AGCTCAGTGG 1381 AAAACAGTGG GGTCAGTCAG TCACCACTCG TGCAAGACCC AGCTTTCTTG TACAAAGTGG 1441 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1501 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1561 ATGGGTCACG GCAGAAACTA CTCCCACGCG TTAAGTCgac aatcaacctc tggattacaa 1621 aatttgtgaa agatt