Transcript: Mouse NM_001289799.1

Mus musculus hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit (Hadhb), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Hadhb (231086)
Length:
2088
CDS:
139..1566

Additional Resources:

NCBI RefSeq record:
NM_001289799.1
NBCI Gene record:
Hadhb (231086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041596 GCAGGGTTAACCATGAATGAT pLKO.1 1237 CDS 100% 5.625 7.875 N Hadhb n/a
2 TRCN0000316706 GCAGGGTTAACCATGAATGAT pLKO_005 1237 CDS 100% 5.625 7.875 N Hadhb n/a
3 TRCN0000041597 CCTATTCGTCATTCAAGAAAT pLKO.1 655 CDS 100% 13.200 9.240 N Hadhb n/a
4 TRCN0000316705 CCTATTCGTCATTCAAGAAAT pLKO_005 655 CDS 100% 13.200 9.240 N Hadhb n/a
5 TRCN0000041595 CATGGCTTGTATCTCTTCAAA pLKO.1 546 CDS 100% 5.625 3.938 N Hadhb n/a
6 TRCN0000316707 CATGGCTTGTATCTCTTCAAA pLKO_005 546 CDS 100% 5.625 3.938 N Hadhb n/a
7 TRCN0000041241 GCACTTCGTATAAAGACCTAA pLKO.1 344 CDS 100% 4.950 3.465 N Gm9108 n/a
8 TRCN0000041593 CCTGCGTTCATCAAACCCTAT pLKO.1 1021 CDS 100% 4.050 2.835 N Hadhb n/a
9 TRCN0000316708 CCTGCGTTCATCAAACCCTAT pLKO_005 1021 CDS 100% 4.050 2.835 N Hadhb n/a
10 TRCN0000041594 CCTTTCTGATATTGTACCCTT pLKO.1 921 CDS 100% 2.640 1.848 N Hadhb n/a
11 TRCN0000316637 CCTTTCTGATATTGTACCCTT pLKO_005 921 CDS 100% 2.640 1.848 N Hadhb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289799.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10432 pDONR223 100% 89% 91.1% None (many diffs) n/a
2 ccsbBroad304_10432 pLX_304 0% 89% 91.1% V5 (many diffs) n/a
3 ccsbBroadEn_10431 pDONR223 100% 88.9% 90.9% None (many diffs) n/a
4 ccsbBroad304_10431 pLX_304 0% 88.9% 90.9% V5 (many diffs) n/a
5 TRCN0000480893 AACCGTCGTCTGCTGCTTGTGTTG pLX_317 33.7% 88.9% 90.9% V5 (many diffs) n/a
Download CSV