Transcript: Human NM_001290232.2

Homo sapiens chromosome 15 open reading frame 41 (C15orf41), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
C15orf41 (84529)
Length:
2578
CDS:
236..787

Additional Resources:

NCBI RefSeq record:
NM_001290232.2
NBCI Gene record:
C15orf41 (84529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167855 GCGAAACATCAGTAAGTTAAT pLKO.1 1885 3UTR 100% 13.200 18.480 N C15orf41 n/a
2 TRCN0000365138 TGCTGTAGAAGGGCACATAAT pLKO_005 550 CDS 100% 13.200 18.480 N C15orf41 n/a
3 TRCN0000167474 GTCATCTATTGGTATGGATTT pLKO.1 674 CDS 100% 10.800 15.120 N C15orf41 n/a
4 TRCN0000173074 CCCACGAACATTGTCACCTTA pLKO.1 749 CDS 100% 4.950 6.930 N C15orf41 n/a
5 TRCN0000365139 TCCACCCTCCAAGTCTATTAT pLKO_005 283 CDS 100% 15.000 10.500 N C15orf41 n/a
6 TRCN0000376573 TCATCTATTGGTATGGATTTA pLKO_005 675 CDS 100% 13.200 9.240 N C15orf41 n/a
7 TRCN0000370259 TGCATTACCATCGTGGAATAA pLKO_005 1249 3UTR 100% 13.200 9.240 N C15orf41 n/a
8 TRCN0000370260 CCAGATGGAGTTCTAGCAAAT pLKO_005 335 CDS 100% 10.800 7.560 N C15orf41 n/a
9 TRCN0000172613 GCATTGTGAACGACTGCTGTT pLKO.1 369 CDS 100% 4.050 2.835 N C15orf41 n/a
10 TRCN0000377521 TACCGAATCACCCTCTTATTT pLKO_005 1154 3UTR 100% 0.000 0.000 N C15orf41 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2372 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04397 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04397 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468087 TTTTTATCTTACACCTCATACCGT pLX_317 82.7% 100% 100% V5 n/a
Download CSV