Transcript: Mouse NM_001290274.1

Mus musculus angiomotin (Amot), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Amot (27494)
Length:
2937
CDS:
1..2562

Additional Resources:

NCBI RefSeq record:
NM_001290274.1
NBCI Gene record:
Amot (27494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126879 GCCCACTAATGCTTCAGAATA pLKO.1 1881 CDS 100% 13.200 18.480 N Amot n/a
2 TRCN0000313826 TTGACTGGTGCGCCCATTATG pLKO_005 2350 CDS 100% 13.200 10.560 N Amot n/a
3 TRCN0000126880 CCAGGAACTCTCAACCTCATA pLKO.1 911 CDS 100% 4.950 3.465 N Amot n/a
4 TRCN0000317410 CCAGGAACTCTCAACCTCATA pLKO_005 911 CDS 100% 4.950 3.465 N Amot n/a
5 TRCN0000126881 GAGAATGTGATGAGACACTTT pLKO.1 1999 CDS 100% 4.950 3.465 N Amot n/a
6 TRCN0000349515 GAGAATGTGATGAGACACTTT pLKO_005 1999 CDS 100% 4.950 3.465 N Amot n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13295 pDONR223 100% 36.9% 38.7% None (many diffs) n/a
2 ccsbBroad304_13295 pLX_304 0% 36.9% 38.7% V5 (many diffs) n/a
3 TRCN0000465916 CCATCAGTCGCCGTTGCAGCGCGC pLX_317 15.7% 36.9% 38.7% V5 (many diffs) n/a
Download CSV