Transcript: Human NM_001290292.1

Homo sapiens short chain dehydrogenase/reductase family 39U member 1 (SDR39U1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
SDR39U1 (56948)
Length:
1165
CDS:
197..832

Additional Resources:

NCBI RefSeq record:
NM_001290292.1
NBCI Gene record:
SDR39U1 (56948)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150580 GCTGCCTTAAAGGAAATTGTA pLKO.1 806 CDS 100% 5.625 3.938 N SDR39U1 n/a
2 TRCN0000155378 CAGTATTCCTTCCCAGAGCTA pLKO.1 782 CDS 100% 2.640 1.848 N SDR39U1 n/a
3 TRCN0000338862 CAGTATTCCTTCCCAGAGCTA pLKO_005 782 CDS 100% 2.640 1.848 N SDR39U1 n/a
4 TRCN0000155046 GCTGAAGCCATCTGGTTCTTA pLKO.1 915 3UTR 100% 5.625 3.375 N SDR39U1 n/a
5 TRCN0000338803 GCTGAAGCCATCTGGTTCTTA pLKO_005 915 3UTR 100% 5.625 3.375 N SDR39U1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476499 ATAGAACACAATGGGTCCCTTACC pLX_317 35.1% 71.7% 62.3% V5 (many diffs) n/a
2 ccsbBroadEn_08674 pDONR223 100% 71.6% 62% None (many diffs) n/a
3 ccsbBroad304_08674 pLX_304 0% 71.6% 62% V5 (many diffs) n/a
Download CSV