Transcript: Mouse NM_001290753.2

Mus musculus Eph receptor B2 (Ephb2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ephb2 (13844)
Length:
10929
CDS:
183..3146

Additional Resources:

NCBI RefSeq record:
NM_001290753.2
NBCI Gene record:
Ephb2 (13844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023305 CGACGTTGTATCTCAGATGAT pLKO.1 3011 CDS 100% 4.950 6.930 N Ephb2 n/a
2 TRCN0000055415 CGAGGATCTTGTTTACAACAT pLKO.1 1241 CDS 100% 4.950 6.930 N Ephb2 n/a
3 TRCN0000055417 CAAGACGTAATCAACGCCATT pLKO.1 2682 CDS 100% 4.050 5.670 N Ephb2 n/a
4 TRCN0000023307 CCAGGCATGAAGATCTATATA pLKO.1 1956 CDS 100% 15.000 10.500 N Ephb2 n/a
5 TRCN0000006426 CGGGAGTTTGCCAAGGAAATT pLKO.1 2013 CDS 100% 13.200 9.240 N EPHB2 n/a
6 TRCN0000023306 CGACGAGAACATGAACACTAT pLKO.1 329 CDS 100% 4.950 3.465 N Ephb2 n/a
7 TRCN0000055413 GCCACAGAGAAGCATACTCTT pLKO.1 3943 3UTR 100% 4.950 3.465 N Ephb2 n/a
8 TRCN0000023308 CCTGAACAGTATCCAGGTGAT pLKO.1 3086 CDS 100% 4.050 2.835 N Ephb2 n/a
9 TRCN0000055416 CCTTAGACATGCCTTGCACAA pLKO.1 1129 CDS 100% 4.050 2.835 N Ephb2 n/a
10 TRCN0000023304 GCCAAGAAACACTTCCAGGAA pLKO.1 3538 3UTR 100% 2.640 1.848 N Ephb2 n/a
11 TRCN0000436520 AGATGATGATGGAGGACATTC pLKO_005 3025 CDS 100% 10.800 6.480 N EPHB2 n/a
12 TRCN0000055414 CCCAATGTCATCCATCTGGAA pLKO.1 2223 CDS 100% 2.640 1.584 N Ephb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487826 CAGTTAACCTTGTCTCTGTAGCCA pLX_317 9.4% 90.8% 99.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488948 GCCAACGTGAGACAAAAACCATAA pLX_317 12.7% 90.8% 99.2% V5 (many diffs) n/a
3 ccsbBroadEn_10804 pDONR223 100% 44.1% 47.9% None (many diffs) n/a
4 ccsbBroad304_10804 pLX_304 0% 44.1% 47.9% V5 (many diffs) n/a
5 TRCN0000468595 AGGACCGTGTTACCCAGCCCCAGT pLX_317 25.8% 44.1% 47.9% V5 (many diffs) n/a
Download CSV