Transcript: Mouse NM_001291074.1

Mus musculus NSFL1 (p97) cofactor (p47) (Nsfl1c), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Nsfl1c (386649)
Length:
1480
CDS:
127..1239

Additional Resources:

NCBI RefSeq record:
NM_001291074.1
NBCI Gene record:
Nsfl1c (386649)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377534 ATCGTGCAGCGGTTAACATAA pLKO_005 1219 CDS 100% 13.200 18.480 N NSFL1C n/a
2 TRCN0000030465 AGCTACCAAGACCCATCCAAT pLKO.1 724 CDS 100% 4.950 3.465 N Nsfl1c n/a
3 TRCN0000279306 AGCTACCAAGACCCATCCAAT pLKO_005 724 CDS 100% 4.950 3.465 N Nsfl1c n/a
4 TRCN0000030464 GTAGTGCTAAAGCTCTGGAAA pLKO.1 670 CDS 100% 4.950 3.465 N Nsfl1c n/a
5 TRCN0000297216 GTAGTGCTAAAGCTCTGGAAA pLKO_005 670 CDS 100% 4.950 3.465 N Nsfl1c n/a
6 TRCN0000030468 CCAGAGGAAGAGTCTGCCTAT pLKO.1 607 CDS 100% 4.050 2.835 N Nsfl1c n/a
7 TRCN0000297657 CCAGAGGAAGAGTCTGCCTAT pLKO_005 607 CDS 100% 4.050 2.835 N Nsfl1c n/a
8 TRCN0000030466 CCCAGGTATTAAACACCAGCT pLKO.1 920 CDS 100% 2.160 1.512 N Nsfl1c n/a
9 TRCN0000279369 CCCAGGTATTAAACACCAGCT pLKO_005 920 CDS 100% 2.160 1.512 N Nsfl1c n/a
10 TRCN0000030467 GATATGGAGGATCATCGGGAT pLKO.1 826 CDS 100% 2.160 1.512 N Nsfl1c n/a
11 TRCN0000279056 GATATGGAGGATCATCGGGAT pLKO_005 826 CDS 100% 2.160 1.512 N Nsfl1c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03687 pDONR223 100% 91.8% 96.2% None (many diffs) n/a
2 ccsbBroad304_03687 pLX_304 0% 91.8% 96.2% V5 (many diffs) n/a
3 TRCN0000480798 GCCCGCGGTGGGCAGTGATTACAG pLX_317 39.2% 91.8% 96.2% V5 (many diffs) n/a
Download CSV