Transcript: Mouse NM_001291142.1

Mus musculus rabaptin, RAB GTPase binding effector protein 1 (Rabep1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Rabep1 (54189)
Length:
5320
CDS:
215..2683

Additional Resources:

NCBI RefSeq record:
NM_001291142.1
NBCI Gene record:
Rabep1 (54189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217407 GCTTCACTTCAGGCTATAATG pLKO.1 557 CDS 100% 13.200 18.480 N Rabep1 n/a
2 TRCN0000337576 CCCTGATAGCAGGATTCTAAC pLKO_005 2686 3UTR 100% 10.800 15.120 N Rabep1 n/a
3 TRCN0000190015 GCTTAGTGAGTGAGACGGAAT pLKO.1 1617 CDS 100% 4.050 5.670 N Rabep1 n/a
4 TRCN0000337511 GCTTAGTGAGTGAGACGGAAT pLKO_005 1617 CDS 100% 4.050 5.670 N Rabep1 n/a
5 TRCN0000191959 GCTATTCTGAATGATACCAAA pLKO.1 2630 CDS 100% 4.950 3.960 N Rabep1 n/a
6 TRCN0000337575 GCTATTCTGAATGATACCAAA pLKO_005 2630 CDS 100% 4.950 3.960 N Rabep1 n/a
7 TRCN0000215505 GATCAAGAAAGAGCAATTAAG pLKO.1 1505 CDS 100% 13.200 9.240 N Rabep1 n/a
8 TRCN0000216888 GGTTAAGGAGCTGAATCATTA pLKO.1 742 CDS 100% 13.200 9.240 N Rabep1 n/a
9 TRCN0000202004 CCAGCTTGAGAAGACGATGAA pLKO.1 1801 CDS 100% 4.950 3.465 N Rabep1 n/a
10 TRCN0000191155 CCATTTAGTAAATCGGACAAT pLKO.1 1259 CDS 100% 4.950 3.465 N Rabep1 n/a
11 TRCN0000048352 CGTTGTGATATGTGTTCCAAT pLKO.1 1688 CDS 100% 4.950 3.465 N RABEP1 n/a
12 TRCN0000363576 CGTTGTGATATGTGTTCCAAT pLKO_005 1688 CDS 100% 4.950 3.465 N RABEP1 n/a
13 TRCN0000337577 TACCATCTGGAGATCCATTTA pLKO_005 1245 CDS 100% 0.000 0.000 N Rabep1 n/a
14 TRCN0000189843 GAGAAGCTGAAGGCGGAAATA pLKO.1 2192 CDS 100% 13.200 7.920 N Rabep1 n/a
15 TRCN0000337512 GAGAAGCTGAAGGCGGAAATA pLKO_005 2192 CDS 100% 13.200 7.920 N Rabep1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07364 pDONR223 100% 86.4% 91.6% None (many diffs) n/a
2 ccsbBroad304_07364 pLX_304 0% 86.4% 91.6% V5 (many diffs) n/a
3 TRCN0000476250 TAGCAGAGCGGCTTTTGTGACGGT pLX_317 14% 86.4% 91.6% V5 (many diffs) n/a
Download CSV