Transcript: Human NM_001291942.2

Homo sapiens chromosome 3 open reading frame 14 (C3orf14), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
C3orf14 (57415)
Length:
3237
CDS:
47..433

Additional Resources:

NCBI RefSeq record:
NM_001291942.2
NBCI Gene record:
C3orf14 (57415)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434563 AGCGATAACTTCTTCACATGC pLKO_005 426 CDS 100% 4.050 5.670 N C3orf14 n/a
2 TRCN0000415796 GACTCGTTACTGGGCATCAGT pLKO_005 298 CDS 100% 3.000 4.200 N C3orf14 n/a
3 TRCN0000167818 GAGAATAAATTGGGTGATCAA pLKO.1 134 CDS 100% 4.950 3.960 N C3orf14 n/a
4 TRCN0000167849 GCAGGAACTTTAGGAATTAAA pLKO.1 501 3UTR 100% 15.000 10.500 N C3orf14 n/a
5 TRCN0000415806 TAAGGTGTATGTAGGTTATTG pLKO_005 481 3UTR 100% 13.200 9.240 N C3orf14 n/a
6 TRCN0000432609 ACTGGGCATCAGTAGAAGAAT pLKO_005 306 CDS 100% 5.625 3.938 N C3orf14 n/a
7 TRCN0000167135 CCAAATGGGAACAGTTTCTTT pLKO.1 333 CDS 100% 5.625 3.938 N C3orf14 n/a
8 TRCN0000168177 CCAAACTGTTGAGACTGCTTT pLKO.1 178 CDS 100% 4.950 3.465 N C3orf14 n/a
9 TRCN0000167760 GAATAAATTGGGTGATCAACA pLKO.1 136 CDS 100% 4.950 3.465 N C3orf14 n/a
10 TRCN0000172384 CTGAGGTGGTTTCTCTTGAGA pLKO.1 279 CDS 100% 3.000 2.100 N C3orf14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03819 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03819 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474827 TTGTGGGATATCTGCACCTATCGC pLX_317 76.2% 100% 100% V5 n/a
Download CSV