Transcript: Human NM_001291943.1

Homo sapiens chromosome 3 open reading frame 14 (C3orf14), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
C3orf14 (57415)
Length:
624
CDS:
208..501

Additional Resources:

NCBI RefSeq record:
NM_001291943.1
NBCI Gene record:
C3orf14 (57415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167818 GAGAATAAATTGGGTGATCAA pLKO.1 295 CDS 100% 4.950 3.960 N C3orf14 n/a
2 TRCN0000168177 CCAAACTGTTGAGACTGCTTT pLKO.1 339 CDS 100% 4.950 3.465 N C3orf14 n/a
3 TRCN0000167760 GAATAAATTGGGTGATCAACA pLKO.1 297 CDS 100% 4.950 3.465 N C3orf14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291943.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03819 pDONR223 100% 59.9% 43.3% None (many diffs) n/a
2 ccsbBroad304_03819 pLX_304 0% 59.9% 43.3% V5 (many diffs) n/a
3 TRCN0000474827 TTGTGGGATATCTGCACCTATCGC pLX_317 76.2% 59.9% 43.3% V5 (many diffs) n/a
Download CSV