Transcript: Human NM_001292038.2

Homo sapiens mannosidase alpha class 2B member 2 (MAN2B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAN2B2 (23324)
Length:
4976
CDS:
23..2899

Additional Resources:

NCBI RefSeq record:
NM_001292038.2
NBCI Gene record:
MAN2B2 (23324)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372959 TGGCGAGCACCCTTCAATTTG pLKO_005 1545 CDS 100% 13.200 18.480 N MAN2B2 n/a
2 TRCN0000372900 TGGCAGGAAATGGTCATATTT pLKO_005 3026 3UTR 100% 15.000 10.500 N MAN2B2 n/a
3 TRCN0000049633 CCTGAGTGAATCCTACAAATA pLKO.1 3763 3UTR 100% 13.200 9.240 N MAN2B2 n/a
4 TRCN0000372899 CTGCGTATGACCTGCTTATTC pLKO_005 1434 CDS 100% 13.200 9.240 N MAN2B2 n/a
5 TRCN0000049635 CCAGCCAACATCAACCTCTAT pLKO.1 788 CDS 100% 4.950 3.465 N MAN2B2 n/a
6 TRCN0000049634 CGGACGTTCTTTATTCACTTT pLKO.1 2867 CDS 100% 4.950 3.465 N MAN2B2 n/a
7 TRCN0000049636 GCCCTACGTTTCCTATGTGAA pLKO.1 2092 CDS 100% 4.950 3.465 N MAN2B2 n/a
8 TRCN0000049637 GCAGGAAATCTTCACGCACAT pLKO.1 631 CDS 100% 4.050 2.835 N MAN2B2 n/a
9 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 4304 3UTR 100% 10.800 5.400 Y LOC388949 n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4144 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07868 pDONR223 100% 94.7% None (many diffs) n/a
2 ccsbBroad304_07868 pLX_304 0% 94.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475805 ATCTCTAAAAAGATGCATGTATGA pLX_317 10.1% 94.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV