Transcript: Human NM_001297441.1

Homo sapiens phosphodiesterase 4B (PDE4B), transcript variant f, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PDE4B (5142)
Length:
3963
CDS:
71..2056

Additional Resources:

NCBI RefSeq record:
NM_001297441.1
NBCI Gene record:
PDE4B (5142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048818 GCATAGTTCAAGCCTAAACAA pLKO.1 790 CDS 100% 5.625 7.875 N PDE4B n/a
2 TRCN0000423795 ACTGAACTCACTGACTAATAA pLKO_005 2387 3UTR 100% 15.000 10.500 N PDE4B n/a
3 TRCN0000427257 ATGCATCATGTATGCTATATT pLKO_005 940 CDS 100% 15.000 10.500 N PDE4B n/a
4 TRCN0000434078 ATAACCTACATGATGACTTTA pLKO_005 1010 CDS 100% 13.200 9.240 N PDE4B n/a
5 TRCN0000413944 ACCATTCTGACGTGGCATATC pLKO_005 1041 CDS 100% 10.800 7.560 N PDE4B n/a
6 TRCN0000114915 CCAGATAAGTGGAGTGAAGAA pLKO.1 763 CDS 100% 4.950 3.465 N Pde4b n/a
7 TRCN0000048822 CCTCCTAAAGACATTCAGAAT pLKO.1 973 CDS 100% 4.950 3.465 N PDE4B n/a
8 TRCN0000048820 CCTTGGAATTGTATCGGCAAT pLKO.1 1557 CDS 100% 4.050 2.835 N PDE4B n/a
9 TRCN0000048819 GCGCAGAGAGTCATTTCTCTA pLKO.1 232 CDS 100% 0.495 0.347 N PDE4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297441.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06703 pDONR223 100% 89.5% 89.1% None (many diffs) n/a
2 ccsbBroad304_06703 pLX_304 0% 89.5% 89.1% V5 (many diffs) n/a
3 TRCN0000477230 ACAAGCGGTCCATTGACATACTCA pLX_317 13.9% 89.5% 89.1% V5 (many diffs) n/a
Download CSV