Transcript: Human NM_001300791.2

Homo sapiens kinesin family member 3A (KIF3A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
KIF3A (11127)
Length:
6311
CDS:
128..2308

Additional Resources:

NCBI RefSeq record:
NM_001300791.2
NBCI Gene record:
KIF3A (11127)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427918 TTCGACTTCAGATGCTTATTA pLKO_005 1962 CDS 100% 15.000 21.000 N KIF3A n/a
2 TRCN0000116816 CGGGATTATCAGGAAATGATT pLKO.1 2000 CDS 100% 5.625 4.500 N KIF3A n/a
3 TRCN0000116812 GCCTGTTTGAACACATTCTAA pLKO.1 2792 3UTR 100% 5.625 4.500 N KIF3A n/a
4 TRCN0000419360 AGCAAGAACGCTTGGATATTG pLKO_005 1773 CDS 100% 13.200 9.240 N KIF3A n/a
5 TRCN0000427122 CACAAAGGTTAGAGGTTAAAG pLKO_005 624 CDS 100% 13.200 9.240 N KIF3A n/a
6 TRCN0000116814 CGTCAGTCTTTGATGAAACTA pLKO.1 2189 CDS 100% 5.625 3.938 N KIF3A n/a
7 TRCN0000116815 GCAACTAATATGAACGAACAT pLKO.1 755 CDS 100% 4.950 3.465 N KIF3A n/a
8 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 5063 3UTR 100% 10.800 5.400 Y MRPL49 n/a
9 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 5063 3UTR 100% 10.800 5.400 Y MRPL49 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3490 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000339512 ATATTGGGCCAGCAGATTATA pLKO_005 1089 CDS 100% 15.000 10.500 N Kif3a n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3491 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5200 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3568 3UTR 100% 4.950 2.475 Y ORAI2 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5200 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14061 pDONR223 100% 96.5% 96% None (many diffs) n/a
2 ccsbBroad304_14061 pLX_304 0% 96.5% 96% V5 (many diffs) n/a
3 TRCN0000478731 ATGAAATGAAAACGAACCGCTTCC pLX_317 14.9% 96.5% 96% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV