Transcript: Human NM_001300843.2

Homo sapiens zinc finger protein 556 (ZNF556), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
ZNF556 (80032)
Length:
1643
CDS:
88..1455

Additional Resources:

NCBI RefSeq record:
NM_001300843.2
NBCI Gene record:
ZNF556 (80032)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416045 TGGGAAGAACATAGCGTTAAA pLKO_005 349 CDS 100% 13.200 18.480 N ZNF556 n/a
2 TRCN0000015958 CCTTACACAAACACGCGAGAA pLKO.1 1070 CDS 100% 4.050 5.670 N ZNF556 n/a
3 TRCN0000015961 GTAGATAATGAGGCTCAGCTT pLKO.1 214 CDS 100% 2.640 3.696 N ZNF556 n/a
4 TRCN0000428163 ACTAGAGAGAAAGTCTATAAA pLKO_005 1177 CDS 100% 15.000 10.500 N ZNF556 n/a
5 TRCN0000015959 CCCATTCCTCATCCCTGATAA pLKO.1 554 CDS 100% 13.200 9.240 N ZNF556 n/a
6 TRCN0000430220 TTGGACAGAAGCCCAGTAAAT pLKO_005 1343 CDS 100% 13.200 9.240 N ZNF556 n/a
7 TRCN0000433217 GAAATCCTTTCGAGTCCATAT pLKO_005 897 CDS 100% 10.800 7.560 N ZNF556 n/a
8 TRCN0000015960 CCTTTCAAGGTCATGTGAGAA pLKO.1 1400 CDS 100% 4.950 3.465 N ZNF556 n/a
9 TRCN0000015962 CTTTACACAAACATGAGAGAA pLKO.1 1235 CDS 100% 4.950 3.465 N ZNF556 n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1534 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1535 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 759 CDS 100% 4.950 2.475 Y ZNF254 n/a
13 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 1589 3UTR 100% 4.050 2.025 Y INTS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300843.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12665 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12665 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472288 GTTTCAGGACCACAATAAGCCCTC pLX_317 35.6% 100% 100% V5 n/a
Download CSV