Transcript: Human NM_001300898.2

Homo sapiens sodium channel and clathrin linker 1 (SCLT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SCLT1 (132320)
Length:
2259
CDS:
437..832

Additional Resources:

NCBI RefSeq record:
NM_001300898.2
NBCI Gene record:
SCLT1 (132320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216044 CTAATGTCATAGAGATCTTTA pLKO.1 1775 3UTR 100% 13.200 9.240 N Pramel6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300898.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13170 pDONR223 100% 59.7% 59.5% None 235_236delAAinsGC;238_393del n/a
2 ccsbBroad304_13170 pLX_304 0% 59.7% 59.5% V5 235_236delAAinsGC;238_393del n/a
3 TRCN0000466235 TGCCGGTGGAACGACGATTACGGG pLX_317 100% 59.7% 59.5% V5 235_236delAAinsGC;238_393del n/a
Download CSV