Transcript: Human NM_001301138.2

Homo sapiens VPS39 subunit of HOPS complex (VPS39), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
VPS39 (23339)
Length:
4856
CDS:
152..2812

Additional Resources:

NCBI RefSeq record:
NM_001301138.2
NBCI Gene record:
VPS39 (23339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381252 GTTATACCTTATACCATTATG pLKO_005 3015 3UTR 100% 13.200 10.560 N VPS39 n/a
2 TRCN0000146371 CCACAAACACTATGACCGAAA pLKO.1 2320 CDS 100% 4.050 3.240 N VPS39 n/a
3 TRCN0000381725 ACGGATGTGTGTGGCAGTAAA pLKO_005 553 CDS 100% 13.200 9.240 N VPS39 n/a
4 TRCN0000148592 CCATGTGGTTTCCCAGTTTAA pLKO.1 391 CDS 100% 13.200 9.240 N VPS39 n/a
5 TRCN0000379937 GTCCATGACCTATTGACATTT pLKO_005 446 CDS 100% 13.200 9.240 N VPS39 n/a
6 TRCN0000381177 ATCTCACCGTGGTACTCAATG pLKO_005 822 CDS 100% 10.800 7.560 N VPS39 n/a
7 TRCN0000379813 ATTACCTCAGGAGGATCAAAC pLKO_005 1010 CDS 100% 10.800 7.560 N VPS39 n/a
8 TRCN0000147158 CTTCTGTTCCAAAGAGGTAAA pLKO.1 2776 CDS 100% 10.800 7.560 N VPS39 n/a
9 TRCN0000379518 GAAACGAAGTCAATTGGTAAA pLKO_005 1417 CDS 100% 10.800 7.560 N VPS39 n/a
10 TRCN0000146521 CCAGCAAACACTCAGATCAAT pLKO.1 2525 CDS 100% 5.625 3.938 N VPS39 n/a
11 TRCN0000146912 CATGGTGTGTAAGAAGAAGAT pLKO.1 2707 CDS 100% 4.950 3.465 N VPS39 n/a
12 TRCN0000146375 CCTCGGCTTCTTAATAGAGAA pLKO.1 1915 CDS 100% 4.950 3.465 N VPS39 n/a
13 TRCN0000120893 GCCAGCAAACACTCAGATCAA pLKO.1 2524 CDS 100% 4.950 3.465 N Vps39 n/a
14 TRCN0000345310 GCCAGCAAACACTCAGATCAA pLKO_005 2524 CDS 100% 4.950 3.465 N Vps39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02753 pDONR223 100% 98.7% 98.6% None 140_172del n/a
2 ccsbBroad304_02753 pLX_304 0% 98.7% 98.6% V5 140_172del n/a
3 TRCN0000472102 CAATCTACATGATTAGCGGGCTCA pLX_317 19.4% 98.7% 98.6% V5 140_172del n/a
4 ccsbBroadEn_11723 pDONR223 100% 80.9% 80.9% None 1_507del n/a
5 ccsbBroad304_11723 pLX_304 0% 80.9% 80.9% V5 1_507del n/a
6 TRCN0000480144 GCATTGTCAAAAATGCGGCATATC pLX_317 17.6% 80.9% 80.9% V5 1_507del n/a
Download CSV