Transcript: Mouse NM_001301304.1

Mus musculus homeodomain interacting protein kinase 1 (Hipk1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hipk1 (15257)
Length:
7939
CDS:
174..3806

Additional Resources:

NCBI RefSeq record:
NM_001301304.1
NBCI Gene record:
Hipk1 (15257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361233 ATACGATCAGATTCGCTATAT pLKO_005 1364 CDS 100% 13.200 18.480 N Hipk1 n/a
2 TRCN0000023157 GCTTCAGAATACGATCAGATT pLKO.1 1356 CDS 100% 4.950 6.930 N Hipk1 n/a
3 TRCN0000361231 CAACCAGTACAGCACTATTAT pLKO_005 2573 CDS 100% 15.000 10.500 N Hipk1 n/a
4 TRCN0000368011 AGCCTGAAGGCGAGGTCTAAT pLKO_005 2949 CDS 100% 13.200 9.240 N Hipk1 n/a
5 TRCN0000361232 TATAACTTTGTCCGTTCTTAT pLKO_005 918 CDS 100% 13.200 9.240 N Hipk1 n/a
6 TRCN0000023154 CGCTCCAAATACAAGCACAAA pLKO.1 1862 CDS 100% 4.950 3.465 N Hipk1 n/a
7 TRCN0000199788 GCAGTCATCTGGATGCTGTAT pLKO.1 3230 CDS 100% 4.950 3.465 N HIPK1 n/a
8 TRCN0000007163 GCCCATGTTGTCAGACAACAA pLKO.1 2661 CDS 100% 0.495 0.347 N HIPK1 n/a
9 TRCN0000361237 TACCCTTTCTCTGGCTAATTC pLKO_005 1967 CDS 100% 0.000 0.000 N Hipk1 n/a
10 TRCN0000007162 CCAGTGTTCTAGCTTCCAGTT pLKO.1 1930 CDS 100% 4.050 2.835 N HIPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301304.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15287 pDONR223 0% 61.3% 65% None (many diffs) n/a
2 ccsbBroad304_15287 pLX_304 0% 61.3% 65% V5 (many diffs) n/a
3 TRCN0000472928 TGTTTACCAACACTAACACTGTCG pLX_317 15.9% 61.3% 65% V5 (many diffs) n/a
4 ccsbBroadEn_15286 pDONR223 62.5% 61% 64.7% None (many diffs) n/a
5 ccsbBroad304_15286 pLX_304 0% 61% 64.7% V5 (many diffs) n/a
Download CSV