Transcript: Human NM_001302109.1

Homo sapiens zinc finger protein 75a (ZNF75A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ZNF75A (7627)
Length:
2692
CDS:
355..1968

Additional Resources:

NCBI RefSeq record:
NM_001302109.1
NBCI Gene record:
ZNF75A (7627)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020247 CAACAGTGTGATAAGAGGTTT pLKO.1 1651 CDS 100% 4.950 6.930 N ZNF75A n/a
2 TRCN0000020248 GTTTAAGGATAGTGCCGGAAA pLKO.1 1257 CDS 100% 4.050 5.670 N ZNF75A n/a
3 TRCN0000418857 TCACTTGAGTTCCTTCTTAAA pLKO_005 2410 3UTR 100% 13.200 10.560 N ZNF75A n/a
4 TRCN0000020246 CAGCCATATACTTGTAGCATA pLKO.1 1888 CDS 100% 4.950 3.960 N ZNF75A n/a
5 TRCN0000430002 CAGTAGCAGGCTTACCAATTT pLKO_005 2286 3UTR 100% 13.200 9.240 N ZNF75A n/a
6 TRCN0000020245 CCTAAAGTGATCTCCTGTCTA pLKO.1 1198 CDS 100% 4.950 3.465 N ZNF75A n/a
7 TRCN0000020244 CCTGTGTCTCTTTCTGACTTA pLKO.1 1324 CDS 100% 4.950 3.465 N ZNF75A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302109.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01805 pDONR223 100% 55.1% 55.1% None 1_723del n/a
2 ccsbBroad304_01805 pLX_304 0% 55.1% 55.1% V5 1_723del n/a
3 TRCN0000474225 AATACCATGACCAACAATAAGCCC pLX_317 52% 55.1% 55.1% V5 1_723del n/a
4 ccsbBroadEn_13749 pDONR223 100% 27.8% 25.5% None (many diffs) n/a
5 ccsbBroad304_13749 pLX_304 0% 27.8% 25.5% V5 (many diffs) n/a
6 TRCN0000466382 ACTACCCGATGGAAACATAATCTC pLX_317 19.4% 27.8% 25.5% V5 (many diffs) n/a
Download CSV