Transcript: Mouse NM_001302468.1

Mus musculus stromal cell derived factor 4 (Sdf4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sdf4 (20318)
Length:
4996
CDS:
241..1326

Additional Resources:

NCBI RefSeq record:
NM_001302468.1
NBCI Gene record:
Sdf4 (20318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001302468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114821 GCCCAGGTTTATTAAAGATAT pLKO.1 1553 3UTR 100% 13.200 9.240 N Sdf4 n/a
2 TRCN0000319869 GCCCAGGTTTATTAAAGATAT pLKO_005 1553 3UTR 100% 13.200 9.240 N Sdf4 n/a
3 TRCN0000056056 CAACTGGGTGAAAGACAGAAA pLKO.1 1065 CDS 100% 4.950 3.465 N SDF4 n/a
4 TRCN0000114822 CCTCAAGTACAGTGAGTTCTT pLKO.1 1254 CDS 100% 4.950 3.465 N Sdf4 n/a
5 TRCN0000350128 CCTCAAGTACAGTGAGTTCTT pLKO_005 1254 CDS 100% 4.950 3.465 N Sdf4 n/a
6 TRCN0000114824 GCCAAGACATTGATGACAACT pLKO.1 1049 CDS 100% 4.950 3.465 N Sdf4 n/a
7 TRCN0000319817 GCCAAGACATTGATGACAACT pLKO_005 1049 CDS 100% 4.950 3.465 N Sdf4 n/a
8 TRCN0000114825 CATGCTCAAGTTCATGGTCAA pLKO.1 933 CDS 100% 4.050 2.835 N Sdf4 n/a
9 TRCN0000319816 CATGCTCAAGTTCATGGTCAA pLKO_005 933 CDS 100% 4.050 2.835 N Sdf4 n/a
10 TRCN0000114823 CACCTCAACAAGGACTTCCAT pLKO.1 451 CDS 100% 3.000 2.100 N Sdf4 n/a
11 TRCN0000350127 CACCTCAACAAGGACTTCCAT pLKO_005 451 CDS 100% 3.000 2.100 N Sdf4 n/a
12 TRCN0000056057 CCGGAGGAAGCTGATGGTCAT pLKO.1 534 CDS 100% 1.350 0.945 N SDF4 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4408 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08233 pDONR223 100% 82.8% 87% None (many diffs) n/a
2 ccsbBroad304_08233 pLX_304 0% 82.8% 87% V5 (many diffs) n/a
3 TRCN0000479256 AAAAACGTTCGGCATAACTCACAC pLX_317 32.7% 82.8% 87% V5 (many diffs) n/a
Download CSV