Transcript: Human NM_001302693.1

Homo sapiens tripartite motif containing 2 (TRIM2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
TRIM2 (23321)
Length:
726
CDS:
118..606

Additional Resources:

NCBI RefSeq record:
NM_001302693.1
NBCI Gene record:
TRIM2 (23321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001302693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037305 CGCCAGATTGACAAGCAGTTT pLKO.1 235 CDS 100% 4.950 3.960 N Trim2 n/a
2 TRCN0000308329 CGCCAGATTGACAAGCAGTTT pLKO_005 235 CDS 100% 4.950 3.960 N Trim2 n/a
3 TRCN0000073036 CGCGCTCCAGAACAATTTCTT pLKO.1 420 CDS 100% 5.625 3.938 N TRIM2 n/a
4 TRCN0000291873 CGCGCTCCAGAACAATTTCTT pLKO_005 420 CDS 100% 5.625 3.938 N TRIM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001302693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02752 pDONR223 100% 17.2% 16.4% None (many diffs) n/a
2 ccsbBroad304_02752 pLX_304 0% 17.2% 16.4% V5 (many diffs) n/a
3 TRCN0000471497 ACCACCTGACCTTTTGCAACCCGA pLX_317 16% 17.2% 16.4% V5 (many diffs) n/a
Download CSV