Transcript: Human NM_001303137.2

Homo sapiens C1q and TNF related 9 (C1QTNF9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-11
Taxon:
Homo sapiens (human)
Gene:
C1QTNF9 (338872)
Length:
1908
CDS:
144..1145

Additional Resources:

NCBI RefSeq record:
NM_001303137.2
NBCI Gene record:
C1QTNF9 (338872)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001303137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371468 TAGTGCTCTGAGGAGTCATAT pLKO_005 1436 3UTR 100% 13.200 9.240 N C1QTNF9 n/a
2 TRCN0000148762 CCAAAGATGCTTACATGAGCT pLKO.1 970 CDS 100% 2.640 1.848 N C1QTNF9 n/a
3 TRCN0000377726 CCGTGACAGAGGAGAGTTTAA pLKO_005 1140 CDS 100% 13.200 7.920 N C1QTNF9 n/a
4 TRCN0000148994 GCACACCAAAGATGCTTACAT pLKO.1 965 CDS 100% 5.625 3.375 N C1QTNF9 n/a
5 TRCN0000371530 CAGCTTGGGATGAACTTATTC pLKO_005 1187 3UTR 100% 13.200 6.600 Y C1QTNF9 n/a
6 TRCN0000439216 GGAAATTCACGTGCCACATTG pLKO_005 859 CDS 100% 10.800 5.400 Y C1QTNF9B n/a
7 TRCN0000149546 GAAATCTGCACAGGGAACATA pLKO.1 174 CDS 100% 5.625 2.813 Y C1QTNF9 n/a
8 TRCN0000149169 GAGAGGTTCAATGGCTTGTTT pLKO.1 1068 CDS 100% 5.625 2.813 Y C1QTNF9 n/a
9 TRCN0000184344 GAAAGGAGATCGAGGAGAGAA pLKO.1 692 CDS 100% 4.950 2.475 Y C1QTNF9B n/a
10 TRCN0000146678 CTATTACTTCACCTACCACAT pLKO.1 887 CDS 100% 4.050 2.025 Y C1QTNF9 n/a
11 TRCN0000146525 CACAGGGAACATAAACTCACA pLKO.1 182 CDS 100% 2.640 1.320 Y C1QTNF9 n/a
12 TRCN0000178839 CATTGAAATCTGCACAGGGAA pLKO.1 170 CDS 100% 2.640 1.320 Y C1QTNF9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001303137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10005 pDONR223 100% 99.5% 99.6% None (many diffs) n/a
2 ccsbBroad304_10005 pLX_304 0% 99.5% 99.6% V5 (many diffs) n/a
3 TRCN0000473757 ATCTTAGTATATGTCATACGGTCC pLX_317 48.2% 99.5% 99.6% V5 (many diffs) n/a
4 ccsbBroadEn_10091 pDONR223 100% 98.7% 97.5% None (many diffs) n/a
5 ccsbBroad304_10091 pLX_304 0% 98.7% 97.5% V5 (many diffs) n/a
6 TRCN0000476007 AGTCCAAGTTCCCATTGGACTTCT pLX_317 35.8% 98.7% 97.5% V5 (many diffs) n/a
Download CSV