Transcript: Human NM_001304385.2

Homo sapiens leucine rich single-pass membrane protein 2 (LSMEM2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LSMEM2 (132228)
Length:
1431
CDS:
28..519

Additional Resources:

NCBI RefSeq record:
NM_001304385.2
NBCI Gene record:
LSMEM2 (132228)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161371 GCTGACCGTTCTGTTTAATTA pLKO.1 1064 3UTR 100% 15.000 21.000 N LSMEM2 n/a
2 TRCN0000165221 GACACTACTCAAACTCCGCTT pLKO.1 441 CDS 100% 2.160 3.024 N LSMEM2 n/a
3 TRCN0000166373 CCCTGAGGAAGGCACATATTT pLKO.1 1260 3UTR 100% 15.000 10.500 N LSMEM2 n/a
4 TRCN0000163789 GCTGCCACATCTACACTATTT pLKO.1 605 3UTR 100% 13.200 9.240 N LSMEM2 n/a
5 TRCN0000163631 GCAGGTTCTGAAGTCTAGAAA pLKO.1 818 3UTR 100% 5.625 3.938 N LSMEM2 n/a
6 TRCN0000162371 CACTATTTCCTTGGTGAGATT pLKO.1 618 3UTR 100% 4.950 3.465 N LSMEM2 n/a
7 TRCN0000166234 CAGGAGGAGACACTACTCAAA pLKO.1 433 CDS 100% 4.950 3.465 N LSMEM2 n/a
8 TRCN0000165705 CCCATAGCAATCACCCAAACT pLKO.1 847 3UTR 100% 4.950 3.465 N LSMEM2 n/a
9 TRCN0000164908 GAGGAGACACTACTCAAACTC pLKO.1 436 CDS 100% 4.950 3.465 N LSMEM2 n/a
10 TRCN0000165352 GATGGCAGGTTCTGAAGTCTA pLKO.1 814 3UTR 100% 4.950 3.465 N LSMEM2 n/a
11 TRCN0000163318 GAGAAAGGAAAGGAAGGGAAA pLKO.1 1215 3UTR 100% 4.050 2.025 Y LSMEM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304385.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04880 pDONR223 100% 99.3% 99.3% None 170_171insAGC n/a
2 ccsbBroad304_04880 pLX_304 0% 99.3% 99.3% V5 170_171insAGC n/a
3 TRCN0000478319 CCTGGCCTTGTAGCACGTATTTCC pLX_317 66.9% 99.3% 99.3% V5 170_171insAGC n/a
Download CSV