Transcript: Human NM_001304483.1

Homo sapiens FYVE, RhoGEF and PH domain containing 4 (FGD4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
FGD4 (121512)
Length:
2834
CDS:
1386..2801

Additional Resources:

NCBI RefSeq record:
NM_001304483.1
NBCI Gene record:
FGD4 (121512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048236 CCCTTGCTTGATACGCACATA pLKO.1 902 5UTR 100% 4.950 6.930 N FGD4 n/a
2 TRCN0000048235 CCGAGATAATGAAGTGACAAT pLKO.1 2312 CDS 100% 4.950 6.930 N FGD4 n/a
3 TRCN0000416144 TTGTGTGGCCAACGGTGTAAT pLKO_005 802 5UTR 100% 13.200 10.560 N FGD4 n/a
4 TRCN0000048234 GCCATTCTAATAGTGCAATAA pLKO.1 1804 CDS 100% 13.200 9.240 N FGD4 n/a
5 TRCN0000446100 GACACGAAGGAGGCATCATTG pLKO_005 2366 CDS 100% 10.800 7.560 N FGD4 n/a
6 TRCN0000048237 CATCAATAAATGCCTTCCATA pLKO.1 1414 CDS 100% 4.950 3.465 N FGD4 n/a
7 TRCN0000048233 CCATGAGATGAAGGAGACTAA pLKO.1 1129 5UTR 100% 4.950 3.465 N FGD4 n/a
8 TRCN0000109956 CCTTCCATAGTAAATTCCTAT pLKO.1 1426 CDS 100% 4.950 3.960 N Fgd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13083 pDONR223 100% 99.7% 99.7% None (many diffs) n/a
2 ccsbBroad304_13083 pLX_304 0% 99.7% 99.7% V5 (many diffs) n/a
3 TRCN0000491703 AGACAAAGGTGCAGGATCGAAAAT pLX_317 24.1% 99.7% 99.7% V5 (many diffs) n/a
Download CSV