Transcript: Human NM_001304500.2

Homo sapiens FGFR1OP N-terminal like (FOPNL), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FOPNL (123811)
Length:
2066
CDS:
19..345

Additional Resources:

NCBI RefSeq record:
NM_001304500.2
NBCI Gene record:
FOPNL (123811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135698 CAATGGATGACCACCTAAGAA pLKO.1 263 CDS 100% 5.625 4.500 N FOPNL n/a
2 TRCN0000134547 GCACCACTAATGTTTGTAGAA pLKO.1 426 3UTR 100% 4.950 3.960 N FOPNL n/a
3 TRCN0000136385 CCTAAGAAAGGAGGAACAGAA pLKO.1 276 CDS 100% 4.950 3.465 N FOPNL n/a
4 TRCN0000134590 GCCCTTAAAGTTTGTAAGGAA pLKO.1 880 3UTR 100% 0.300 0.210 N FOPNL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04776 pDONR223 100% 62% 58.6% None 27_28ins198 n/a
2 ccsbBroad304_04776 pLX_304 0% 62% 58.6% V5 27_28ins198 n/a
3 TRCN0000475080 AAAAACCCATATGCCCGTAGCTCC pLX_317 70.4% 62% 58.6% V5 27_28ins198 n/a
Download CSV