Transcript: Mouse NM_001304542.1

Mus musculus solute carrier family 9 (sodium/hydrogen exchanger), member 8 (Slc9a8), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Slc9a8 (77031)
Length:
4460
CDS:
43..1680

Additional Resources:

NCBI RefSeq record:
NM_001304542.1
NBCI Gene record:
Slc9a8 (77031)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068679 CGGCTGAAGGTCTAACAAGAA pLKO.1 662 CDS 100% 4.950 3.960 N Slc9a8 n/a
2 TRCN0000068682 GCATCGTGATGTCACACTATA pLKO.1 917 CDS 100% 13.200 9.240 N Slc9a8 n/a
3 TRCN0000068678 CCCTGTAATGTGAAGCTCCTT pLKO.1 2250 3UTR 100% 2.640 1.848 N Slc9a8 n/a
4 TRCN0000068681 CCTGTGTGAAACGTGTGTGTT pLKO.1 1002 CDS 100% 4.950 2.970 N Slc9a8 n/a
5 TRCN0000432915 GTAGTAGGTGGAGGAATTTAT pLKO_005 448 CDS 100% 15.000 10.500 N SLC9A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304542.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07866 pDONR223 100% 83.8% 90.3% None (many diffs) n/a
2 ccsbBroad304_07866 pLX_304 0% 83.8% 90.3% V5 (many diffs) n/a
3 TRCN0000478106 TGATCCCTTCCATCACCAATCCGC pLX_317 15.4% 83.8% 90.3% V5 (many diffs) n/a
Download CSV