Transcript: Human NM_001304548.2

Homo sapiens cilia and flagella associated protein 47 (CFAP47), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-01
Taxon:
Homo sapiens (human)
Gene:
CFAP47 (286464)
Length:
9941
CDS:
67..9630

Additional Resources:

NCBI RefSeq record:
NM_001304548.2
NBCI Gene record:
CFAP47 (286464)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167221 CGGCTACTTATTTCAATAGAA pLKO.1 418 CDS 100% 5.625 7.875 N CFAP47 n/a
2 TRCN0000145526 GAGACTATAAGAAGGGATGTA pLKO.1 4744 CDS 100% 4.950 6.930 N CFAP47 n/a
3 TRCN0000168831 CGCAAGAATTATGCACCTGTA pLKO.1 1726 CDS 100% 4.050 5.670 N CFAP47 n/a
4 TRCN0000141263 CCAGAGACTATAAGAAGGGAT pLKO.1 4741 CDS 100% 2.640 2.112 N CFAP47 n/a
5 TRCN0000269683 ATTGGTCTTCAGTCAACTATT pLKO_005 8332 CDS 100% 13.200 9.240 N CFAP47 n/a
6 TRCN0000269719 CAAGCAATACACTGGATATAC pLKO_005 8698 CDS 100% 13.200 9.240 N CFAP47 n/a
7 TRCN0000269681 GGGAATCGACAGCGAAGAAAT pLKO_005 8676 CDS 100% 13.200 9.240 N CFAP47 n/a
8 TRCN0000269684 GTAGAACTTTGATGACTATTA pLKO_005 9662 3UTR 100% 13.200 9.240 N CFAP47 n/a
9 TRCN0000269674 TTATCTGGAGTAGGACTATTT pLKO_005 8275 CDS 100% 13.200 9.240 N CFAP47 n/a
10 TRCN0000140066 CAACACAGTTGGGAGCCTATT pLKO.1 5453 CDS 100% 10.800 7.560 N CFAP47 n/a
11 TRCN0000168634 GCCAGTGAAGGATATGCTATT pLKO.1 1800 CDS 100% 10.800 7.560 N CFAP47 n/a
12 TRCN0000142319 GAACCTGCAAAGGGAAACTTA pLKO.1 4504 CDS 100% 5.625 3.938 N CFAP47 n/a
13 TRCN0000167652 GAGATGCTCTTGAGTATCAAA pLKO.1 745 CDS 100% 5.625 3.938 N CFAP47 n/a
14 TRCN0000144022 CCATTCTTGATTGAGTCTCAT pLKO.1 5476 CDS 100% 4.950 3.465 N CFAP47 n/a
15 TRCN0000143034 CCTGAAGAGTATCTGCACAAT pLKO.1 5527 CDS 100% 4.950 3.465 N CFAP47 n/a
16 TRCN0000142490 GACCTTTCAGATGGTCTTGTT pLKO.1 5428 CDS 100% 4.950 3.465 N CFAP47 n/a
17 TRCN0000144839 GAAATTGACTTTGACGTGGAA pLKO.1 5575 CDS 100% 2.640 1.848 N CFAP47 n/a
18 TRCN0000140895 GAAGATCATGGGTCTCTGGAA pLKO.1 4585 CDS 100% 2.640 1.848 N CFAP47 n/a
19 TRCN0000168579 GCAGCTTAATGTTGACACCAA pLKO.1 2276 CDS 100% 2.640 1.584 N CFAP47 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304548.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14424 pDONR223 100% 23.5% 23.5% None (many diffs) n/a
2 ccsbBroad304_14424 pLX_304 0% 23.5% 23.5% V5 (many diffs) n/a
3 TRCN0000471143 TTCTTACTATCCCATGCCCGGGTT pLX_317 20.4% 23.5% 23.5% V5 (many diffs) n/a
4 ccsbBroadEn_05415 pDONR223 100% 14.7% 13.3% None (many diffs) n/a
5 ccsbBroad304_05415 pLX_304 0% 14.7% 13.3% V5 (many diffs) n/a
6 TRCN0000476305 AGCAGAGGGTAGTGAACCTATGTC pLX_317 14.1% 14.7% 13.3% V5 (many diffs) n/a
Download CSV