Transcript: Mouse NM_001304992.1

Mus musculus protein phosphatase 3, catalytic subunit, gamma isoform (Ppp3cc), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ppp3cc (19057)
Length:
1932
CDS:
648..1685

Additional Resources:

NCBI RefSeq record:
NM_001304992.1
NBCI Gene record:
Ppp3cc (19057)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001304992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012697 CGAGGTCTAGACCGAATTAAT pLKO.1 1542 CDS 100% 15.000 21.000 N Ppp3cc n/a
2 TRCN0000006876 GCCCTCTTAAACCAGCAGTTT pLKO.1 696 CDS 100% 4.950 3.960 N PPP3CC n/a
3 TRCN0000012693 CCTATGAGCAAATCACATTTA pLKO.1 1723 3UTR 100% 13.200 9.240 N Ppp3cc n/a
4 TRCN0000012695 GCTGTATCTATGGAGCTTAAA pLKO.1 521 5UTR 100% 13.200 9.240 N Ppp3cc n/a
5 TRCN0000012696 CGGATGAAGAAATGAACGTAA pLKO.1 1249 CDS 100% 4.950 3.465 N Ppp3cc n/a
6 TRCN0000012694 CGGCTAACTTTGAAGGAAGTT pLKO.1 341 5UTR 100% 0.495 0.347 N Ppp3cc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06761 pDONR223 100% 56.3% 56.6% None (many diffs) n/a
2 ccsbBroad304_06761 pLX_304 0% 56.3% 56.6% V5 (many diffs) n/a
3 TRCN0000475207 ACGACCATGATACGACGGACCGAT pLX_317 21.2% 56.3% 56.6% V5 (many diffs) n/a
Download CSV