Transcript: Human NM_001305010.1

Homo sapiens lunapark, ER junction formation factor (LNPK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
LNPK (80856)
Length:
7442
CDS:
56..1348

Additional Resources:

NCBI RefSeq record:
NM_001305010.1
NBCI Gene record:
LNPK (80856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001305010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279675 ACGATGTTCTTGATGATAATA pLKO_005 1128 CDS 100% 15.000 21.000 N LNPK n/a
2 TRCN0000128745 CGTGCCTTCAACTGGATATTT pLKO.1 1361 3UTR 100% 15.000 21.000 N LNPK n/a
3 TRCN0000279674 TTTGACGGCAGAGTAGTAAAT pLKO_005 1333 CDS 100% 13.200 18.480 N LNPK n/a
4 TRCN0000248061 ATGAAGCATTGGATGATTTAA pLKO_005 378 CDS 100% 15.000 10.500 N Lnpk n/a
5 TRCN0000279604 GTATGTATAACCCGTAAATAT pLKO_005 1651 3UTR 100% 15.000 10.500 N LNPK n/a
6 TRCN0000129814 CTGGAGCATAAGAACAGTAAT pLKO.1 322 CDS 100% 13.200 9.240 N LNPK n/a
7 TRCN0000130072 GAAACTTACAAGACGGCTAAA pLKO.1 440 CDS 100% 10.800 7.560 N LNPK n/a
8 TRCN0000279672 GAAACTTACAAGACGGCTAAA pLKO_005 440 CDS 100% 10.800 7.560 N LNPK n/a
9 TRCN0000128139 CAGACAAACCAAGTGATTGAA pLKO.1 1184 CDS 100% 5.625 3.938 N LNPK n/a
10 TRCN0000279603 CAGACAAACCAAGTGATTGAA pLKO_005 1184 CDS 100% 5.625 3.938 N LNPK n/a
11 TRCN0000128787 CCTGAACTAAGTGGAGAATCT pLKO.1 1313 CDS 100% 4.950 3.465 N LNPK n/a
12 TRCN0000130543 GCTTTCATCAGACAACCAGTT pLKO.1 1087 CDS 100% 4.050 2.835 N LNPK n/a
13 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5536 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12710 pDONR223 100% 70.9% 70.9% None 1_375del n/a
2 ccsbBroad304_12710 pLX_304 0% 70.9% 70.9% V5 1_375del n/a
3 TRCN0000478068 GACAGACTTCTTAGGATCCTTCGA pLX_317 23.2% 70.9% 70.9% V5 1_375del n/a
Download CSV