Transcript: Human NM_001306177.2

Homo sapiens Rac/Cdc42 guanine nucleotide exchange factor 6 (ARHGEF6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ARHGEF6 (9459)
Length:
5233
CDS:
886..2754

Additional Resources:

NCBI RefSeq record:
NM_001306177.2
NBCI Gene record:
ARHGEF6 (9459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001306177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007404 CGTCATCATGTAGTGCTCATT pLKO.1 2105 CDS 100% 4.950 3.960 N ARHGEF6 n/a
2 TRCN0000279991 CGTCATCATGTAGTGCTCATT pLKO_005 2105 CDS 100% 4.950 3.960 N ARHGEF6 n/a
3 TRCN0000007402 CCAGTAATTATGTCCGTGAAA pLKO.1 1052 CDS 100% 4.950 3.465 N ARHGEF6 n/a
4 TRCN0000007401 CCGTGGAGTTTAAGTTGTCTA pLKO.1 2185 CDS 100% 4.950 3.465 N ARHGEF6 n/a
5 TRCN0000280057 CCGTGGAGTTTAAGTTGTCTA pLKO_005 2185 CDS 100% 4.950 3.465 N ARHGEF6 n/a
6 TRCN0000007400 GCTGAATGATTTGACTCAGTT pLKO.1 2808 3UTR 100% 4.950 3.465 N ARHGEF6 n/a
7 TRCN0000279990 GCTGAATGATTTGACTCAGTT pLKO_005 2808 3UTR 100% 4.950 3.465 N ARHGEF6 n/a
8 TRCN0000007403 GCCTGGAAGAAGAACTGAAAT pLKO.1 2636 CDS 100% 13.200 7.920 N ARHGEF6 n/a
9 TRCN0000280058 GCCTGGAAGAAGAACTGAAAT pLKO_005 2636 CDS 100% 13.200 7.920 N ARHGEF6 n/a
10 TRCN0000415811 GCTGAGGTGGGAGGATCATTT pLKO_005 4308 3UTR 100% 13.200 6.600 Y SULT1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001306177.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11368 pDONR223 100% 86.4% 86.4% None 1615_1866del n/a
2 ccsbBroad304_11368 pLX_304 0% 86.4% 86.4% V5 1615_1866del n/a
3 TRCN0000481486 CTGCCTACAAACCATCTCCCTGGA pLX_317 29.9% 86.4% 86.4% V5 1615_1866del n/a
Download CSV