Transcript: Human NM_001307987.2

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 (ST8SIA5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ST8SIA5 (29906)
Length:
13804
CDS:
546..1583

Additional Resources:

NCBI RefSeq record:
NM_001307987.2
NBCI Gene record:
ST8SIA5 (29906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001307987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431529 TATATCGAAGACTTAGCTATG pLKO_005 2061 3UTR 100% 6.000 4.200 N ST8SIA5 n/a
2 TRCN0000035301 GAGCCGAACTTTGCTCTTCAT pLKO.1 587 CDS 100% 4.950 3.465 N ST8SIA5 n/a
3 TRCN0000419976 GGGACAAAGCTCAAGTATGAG pLKO_005 831 CDS 100% 4.950 3.465 N ST8SIA5 n/a
4 TRCN0000035300 CCTCTACATCACTCACCACTA pLKO.1 1442 CDS 100% 4.050 2.835 N ST8SIA5 n/a
5 TRCN0000035303 CAGCATCATCACAGAGAGGTT pLKO.1 1097 CDS 100% 2.640 1.848 N ST8SIA5 n/a
6 TRCN0000035302 CCAGTTTAAGAAGTGTGCTGT pLKO.1 929 CDS 100% 2.640 1.848 N ST8SIA5 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5815 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 11631 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5815 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001307987.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03100 pDONR223 100% 91.7% 91.7% None 131_132ins93 n/a
2 ccsbBroad304_03100 pLX_304 0% 91.7% 91.7% V5 131_132ins93 n/a
3 TRCN0000474698 TTGTATGGGTTAGAATCATCGGTC pLX_317 46.3% 91.7% 91.7% V5 131_132ins93 n/a
Download CSV