Transcript: Human NM_001308433.1

Homo sapiens NME/NM23 nucleoside diphosphate kinase 6 (NME6), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
NME6 (10201)
Length:
2998
CDS:
141..632

Additional Resources:

NCBI RefSeq record:
NM_001308433.1
NBCI Gene record:
NME6 (10201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146177 TACCTCCAGAATCAGTGGAT pXPR_003 GGG 76 15% 2 0.6438 NME6 NME6 76223
2 BRDN0001145496 AGTGTTCCGAGCACGCCATG pXPR_003 TGG 285 58% 4 0.0426 NME6 NME6 76222
3 BRDN0001148253 TGTGGGCAAGGATGTAGGCT pXPR_003 CGG 208 42% 4 -0.0012 NME6 NME6 76221
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219687 TCCAGGATCTAGCCTTCTATC pLKO.1 813 3UTR 100% 10.800 15.120 N NME6 n/a
2 TRCN0000332973 TCCAGGATCTAGCCTTCTATC pLKO_005 813 3UTR 100% 10.800 15.120 N NME6 n/a
3 TRCN0000010191 CCAATCCGAGCCTACATCCTT pLKO.1 338 CDS 100% 3.000 4.200 N NME6 n/a
4 TRCN0000344507 CCAATCCGAGCCTACATCCTT pLKO_005 338 CDS 100% 3.000 4.200 N NME6 n/a
5 TRCN0000010188 CACTCTAGCCCTGATCAAGCC pLKO.1 179 CDS 100% 0.720 1.008 N NME6 n/a
6 TRCN0000344573 CACTCTAGCCCTGATCAAGCC pLKO_005 179 CDS 100% 0.720 1.008 N NME6 n/a
7 TRCN0000199067 CCACCCATGGTTCGGACTCTG pLKO.1 480 CDS 100% 0.000 0.000 N NME6 n/a
8 TRCN0000010182 GTTTCAGCCAGCAGAGAGATT pLKO.1 503 CDS 100% 4.950 3.465 N NME6 n/a
9 TRCN0000199549 CAGTCGCCCATCCACTGATTC pLKO.1 205 CDS 100% 3.600 2.520 N NME6 n/a
10 TRCN0000010189 GAACTACTGTGGAGAAAGGAA pLKO.1 282 CDS 100% 3.000 2.100 N NME6 n/a
11 TRCN0000199487 GCCTCAATCTTGCGAAGCCCT pLKO.1 144 CDS 100% 0.220 0.154 N NME6 n/a
12 TRCN0000219686 CCAGACTTCTCCTAGACATCT pLKO.1 691 3UTR 100% 4.950 2.970 N NME6 n/a
13 TRCN0000084008 CGCCTATAATCCCAGCACTTT pLKO.1 946 3UTR 100% 4.950 2.475 Y NPHS1 n/a
14 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1012 3UTR 100% 13.200 6.600 Y IQCC n/a
15 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1109 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 2634 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02350 pDONR223 100% 84% 37.7% None 0_1ins24;191_192ins40;489_490ins29 n/a
2 ccsbBroad304_02350 pLX_304 0% 84% 37.7% V5 0_1ins24;191_192ins40;489_490ins29 n/a
3 TRCN0000471879 ATATGCAGCTGCTAATGATAACTA pLX_317 86.2% 84% 37.7% V5 0_1ins24;191_192ins40;489_490ins29 n/a
4 ccsbBroadEn_14957 pDONR223 0% 84% 37.7% None 0_1ins24;191_192ins40;489_490ins29 n/a
5 ccsbBroad304_14957 pLX_304 0% 84% 37.7% V5 0_1ins24;191_192ins40;489_490ins29 n/a
6 TRCN0000492136 CGACAGGAGTATCTTATTCTTTTT pLX_317 33.8% 84% 37.7% V5 0_1ins24;191_192ins40;489_490ins29 n/a
7 TRCN0000491599 GGACTGGACCCGACACTCACGCAG pLX_317 45.8% 84% 37.7% V5 (not translated due to prior stop codon) 0_1ins24;191_192ins40;489_490ins29 n/a
Download CSV