Transcript: Human NM_001308440.1

Homo sapiens ZFP28 zinc finger protein (ZFP28), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ZFP28 (140612)
Length:
3513
CDS:
72..1121

Additional Resources:

NCBI RefSeq record:
NM_001308440.1
NBCI Gene record:
ZFP28 (140612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001308440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232344 AGAGACTCACAAGCTATAATC pLKO_005 679 CDS 100% 13.200 9.240 N ZFP28 n/a
2 TRCN0000017051 GCTGGGACTTTGTGTTTCTAA pLKO.1 494 CDS 100% 5.625 3.938 N ZFP28 n/a
3 TRCN0000017050 CCAGATTTAGTCTCTTTACTA pLKO.1 891 CDS 100% 5.625 3.375 N ZFP28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001308440.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16097 pDONR223 0% 99.8% 99.4% None 29G>A;971C>T n/a
2 ccsbBroad304_16097 pLX_304 0% 99.8% 99.4% V5 29G>A;971C>T n/a
3 TRCN0000474632 TAGCGTTTCGTGTGATGTGCTTTC pLX_317 38.4% 99.8% 99.4% V5 29G>A;971C>T n/a
4 ccsbBroadEn_09590 pDONR223 100% 37.6% 35.7% None (many diffs) n/a
5 ccsbBroad304_09590 pLX_304 0% 37.6% 35.7% V5 (many diffs) n/a
6 TRCN0000474070 AGTCCACGCACTTCCCATCACCAT pLX_317 2.2% 37.6% 35.7% V5 (many diffs) n/a
Download CSV