Transcript: Human NM_001309842.2

Homo sapiens GNAS complex locus (GNAS), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
GNAS (2778)
Length:
1114
CDS:
307..570

Additional Resources:

NCBI RefSeq record:
NM_001309842.2
NBCI Gene record:
GNAS (2778)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001309842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115056 CCTGCATGTTAATGGGTTTAA pLKO.1 492 CDS 100% 13.200 9.240 N Gnas n/a
2 TRCN0000320192 CCTGCATGTTAATGGGTTTAA pLKO_005 492 CDS 100% 13.200 9.240 N Gnas n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001309842.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15431 pDONR223 0% 21.9% 21.8% None 258_258delAinsTG;260T>G;261_262ins920 n/a
2 ccsbBroad304_15431 pLX_304 0% 21.9% 21.8% V5 258_258delAinsTG;260T>G;261_262ins920 n/a
3 TRCN0000473616 GACTTATCGCTAGTTCTTCAGTAC pLX_317 47.5% 21.9% 21.8% V5 258_258delAinsTG;260T>G;261_262ins920 n/a
4 ccsbBroadEn_00652 pDONR223 100% 21.7% 21.7% None 258A>C;260_261delTAins926 n/a
5 ccsbBroad304_00652 pLX_304 0% 21.7% 21.7% V5 258A>C;260_261delTAins926 n/a
6 TRCN0000478852 GCCGCACGACTCTCAATGTTCATT pLX_317 29.2% 21.7% 21.7% V5 258A>C;260_261delTAins926 n/a
Download CSV