Transcript: Human NM_001310332.1

Homo sapiens ring finger protein 31 (RNF31), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
RNF31 (55072)
Length:
3227
CDS:
359..3124

Additional Resources:

NCBI RefSeq record:
NM_001310332.1
NBCI Gene record:
RNF31 (55072)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001310332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250109 CCGAGATGTGCTGCGATTATA pLKO_005 186 5UTR 100% 15.000 21.000 N RNF31 n/a
2 TRCN0000168448 GCGTGGTGTCAAGTTTAATAA pLKO.1 126 5UTR 100% 15.000 12.000 N RNF31 n/a
3 TRCN0000168495 GCACACTACAAAGAGTATCTT pLKO.1 2903 CDS 100% 5.625 4.500 N RNF31 n/a
4 TRCN0000250111 TGCTCCTTTGGCTTCATATAT pLKO_005 2309 CDS 100% 15.000 10.500 N RNF31 n/a
5 TRCN0000257995 ACGCATGAACGACCCAGAATA pLKO_005 2449 CDS 100% 13.200 9.240 N RNF31 n/a
6 TRCN0000250110 CTGGCGTGGTGTCAAGTTTAA pLKO_005 123 5UTR 100% 13.200 9.240 N RNF31 n/a
7 TRCN0000250112 TAATCCTGCAAGTGCTCATTT pLKO_005 790 CDS 100% 13.200 9.240 N RNF31 n/a
8 TRCN0000173010 GTGCCATGCTAAATGAGCCTT pLKO.1 831 CDS 100% 2.640 1.848 N RNF31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310332.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12151 pDONR223 100% 63.9% 63.9% None 1_996del n/a
2 ccsbBroad304_12151 pLX_304 0% 63.9% 63.9% V5 1_996del n/a
3 TRCN0000480205 GCTGTATCCGTGGGTCTAAAATTG pLX_317 22.5% 63.9% 63.9% V5 1_996del n/a
Download CSV