Transcript: Mouse NM_001310513.1

Mus musculus KAT8 regulatory NSL complex subunit 3 (Kansl3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kansl3 (226976)
Length:
4741
CDS:
129..2840

Additional Resources:

NCBI RefSeq record:
NM_001310513.1
NBCI Gene record:
Kansl3 (226976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266994 TGGCTCAGAATAAGCTATTTA pLKO_005 529 CDS 100% 15.000 12.000 N Kansl3 n/a
2 TRCN0000283400 GCAACTCCTGTTCCACTTTAT pLKO_005 381 CDS 100% 13.200 10.560 N Kansl3 n/a
3 TRCN0000266993 TTCATAGGTCAGAGCATATAA pLKO_005 4066 3UTR 100% 15.000 10.500 N Kansl3 n/a
4 TRCN0000266996 AGCATGGTGGACAGATGTATT pLKO_005 1488 CDS 100% 13.200 9.240 N Kansl3 n/a
5 TRCN0000365610 AGCATGGTGGACAGATGTATT pLKO_005 1488 CDS 100% 13.200 9.240 N KANSL3 n/a
6 TRCN0000217224 CAACCAAGCATCAGGCTTAAA pLKO.1 2672 CDS 100% 13.200 9.240 N Kansl3 n/a
7 TRCN0000266995 CTCCAGTCCTCTTCGTCATTG pLKO_005 1321 CDS 100% 10.800 7.560 N Kansl3 n/a
8 TRCN0000183763 CCTGTTCCACTTTATGACAAT pLKO.1 387 CDS 100% 4.950 3.465 N Kansl3 n/a
9 TRCN0000179171 GCCTAAGAAGAGCTAGAGAAA pLKO.1 3387 3UTR 100% 4.950 3.465 N Kansl3 n/a
10 TRCN0000183489 GCTTCAAAGTTTGTCTCCTTT pLKO.1 3542 3UTR 100% 4.950 3.465 N Kansl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03629 pDONR223 100% 86.6% 91.7% None (many diffs) n/a
2 ccsbBroad304_03629 pLX_304 0% 86.6% 91.7% V5 (many diffs) n/a
3 TRCN0000470202 ACTTGCCGGATACGATAAGGAAAG pLX_317 15.3% 86.6% 79.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV