Transcript: Mouse NM_001310521.1

Mus musculus ankyrin repeat domain 23 (Ankrd23), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ankrd23 (78321)
Length:
2321
CDS:
376..954

Additional Resources:

NCBI RefSeq record:
NM_001310521.1
NBCI Gene record:
Ankrd23 (78321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420605 CGAAACTGCTGCTGCTCTATG pLKO_005 812 CDS 100% 10.800 15.120 N Ankrd23 n/a
2 TRCN0000103804 GATAGGAAAGCGTTGGAGTTT pLKO.1 79 5UTR 100% 4.950 6.930 N Ankrd23 n/a
3 TRCN0000103803 GCTGCTATAGAAGTACGGGAT pLKO.1 538 CDS 100% 2.160 3.024 N Ankrd23 n/a
4 TRCN0000103800 CCAGTCCTAAATAGTTCTTTA pLKO.1 1003 3UTR 100% 13.200 10.560 N Ankrd23 n/a
5 TRCN0000434733 ACGGACTGGTCTTGGCCTATT pLKO_005 1252 3UTR 100% 10.800 7.560 N Ankrd23 n/a
6 TRCN0000428175 CATTCTCAAACGGCTGCTTAA pLKO_005 609 CDS 100% 10.800 7.560 N Ankrd23 n/a
7 TRCN0000103802 CCACATCAACGCACAGGATAA pLKO.1 738 CDS 100% 10.800 7.560 N Ankrd23 n/a
8 TRCN0000103801 CTTGGTTCAAAGACGAAGAAA pLKO.1 264 5UTR 100% 5.625 3.938 N Ankrd23 n/a
9 TRCN0000443403 GTTCTAGCCATCTCGTCTTCA pLKO_005 1431 3UTR 100% 4.950 3.465 N Ankrd23 n/a
10 TRCN0000423412 TCAACGCACAAGACAAGATCT pLKO_005 644 CDS 100% 4.950 3.465 N Ankrd23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05188 pDONR223 100% 54.5% 54% None (many diffs) n/a
2 ccsbBroad304_05188 pLX_304 0% 54.5% 54% V5 (many diffs) n/a
3 TRCN0000468423 AGATGTTTGCTGATACTGACCGTC pLX_317 37.2% 54.5% 54% V5 (many diffs) n/a
Download CSV