Transcript: Mouse NM_001310727.1

Mus musculus lysine methyltransferase 5A (Kmt5a), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Kmt5a (67956)
Length:
2746
CDS:
246..1133

Additional Resources:

NCBI RefSeq record:
NM_001310727.1
NBCI Gene record:
Kmt5a (67956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001310727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241072 ACACTCACTCTTAGCTAATTA pLKO_005 1254 3UTR 100% 15.000 21.000 N Kmt5a n/a
2 TRCN0000241071 AGGAACACCGGGAACGTTATA pLKO_005 369 CDS 100% 13.200 18.480 N Kmt5a n/a
3 TRCN0000241074 AGGCATGAAGATTGATCTAAT pLKO_005 722 CDS 100% 13.200 18.480 N Kmt5a n/a
4 TRCN0000179272 GCAGTCAAAGATCTATGCCTA pLKO.1 224 5UTR 100% 2.640 2.112 N Kmt5a n/a
5 TRCN0000359372 TTGAACAGATGGCCTTATATT pLKO_005 1356 3UTR 100% 15.000 10.500 N KMT5A n/a
6 TRCN0000241070 TGGCTGCTACATGTACTATTT pLKO_005 878 CDS 100% 13.200 9.240 N Kmt5a n/a
7 TRCN0000241073 GTGTTTGCTGGGCAGTCAAAG pLKO_005 213 5UTR 100% 10.800 7.560 N Kmt5a n/a
8 TRCN0000183941 CGTTATACGAAGCGCTGTGAA pLKO.1 383 CDS 100% 4.950 3.465 N Kmt5a n/a
9 TRCN0000128082 CAAAGGACAAAGTGCCCTCAA pLKO.1 1173 3UTR 100% 4.050 2.835 N KMT5A n/a
10 TRCN0000178741 CACACACATACACACACACAA pLKO.1 1233 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10090 pDONR223 99.7% 74.1% 77.2% None (many diffs) n/a
2 TRCN0000469703 CTAATGACGTGGACCACCAACCCG pLX_317 46.1% 74.1% 77.2% V5 (many diffs) n/a
3 ccsbBroad304_10090 pLX_304 62.4% 74.1% 20.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV