Transcript: Mouse NM_001311107.1

Mus musculus transmembrane and coiled-coil domains 2 (Tmcc2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tmcc2 (68875)
Length:
3551
CDS:
445..2331

Additional Resources:

NCBI RefSeq record:
NM_001311107.1
NBCI Gene record:
Tmcc2 (68875)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001311107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124365 CCGAGATCCAACACTCTTTAT pLKO.1 1711 CDS 100% 13.200 18.480 N Tmcc2 n/a
2 TRCN0000425114 AGGATGCTCTAGTCATGTAAG pLKO_005 2629 3UTR 100% 10.800 15.120 N Tmcc2 n/a
3 TRCN0000445284 CAAGGATGTGCTACGCGATAT pLKO_005 1320 CDS 100% 10.800 15.120 N Tmcc2 n/a
4 TRCN0000124364 CCAGGGCTGCATTATTTGAAT pLKO.1 2570 3UTR 100% 5.625 4.500 N Tmcc2 n/a
5 TRCN0000124366 CCAGCGAACTAAGGCTGCCAT pLKO.1 1047 CDS 100% 0.880 0.704 N Tmcc2 n/a
6 TRCN0000434037 AGGGACACTCTCAGCCAAATG pLKO_005 2533 3UTR 100% 10.800 7.560 N Tmcc2 n/a
7 TRCN0000438436 CCATGGAGATGGTCTGGATAA pLKO_005 2721 3UTR 100% 10.800 7.560 N Tmcc2 n/a
8 TRCN0000421939 TCTCAGAGGGCTCCATGTTTG pLKO_005 431 5UTR 100% 10.800 7.560 N Tmcc2 n/a
9 TRCN0000420579 AGTCCTCACCTGCTTCGTAAG pLKO_005 775 CDS 100% 6.000 4.200 N Tmcc2 n/a
10 TRCN0000124368 ACTGCTTTCAACCGGGTGTTA pLKO.1 646 CDS 100% 4.950 3.465 N Tmcc2 n/a
11 TRCN0000423231 AGATCACTGAGCAGATCAAGA pLKO_005 1094 CDS 100% 4.950 3.465 N Tmcc2 n/a
12 TRCN0000124367 CCAGAATGAAATGACCAACCT pLKO.1 1929 CDS 100% 2.640 1.848 N Tmcc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001311107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07509 pDONR223 100% 78.2% 84.5% None (many diffs) n/a
2 ccsbBroad304_07509 pLX_304 0% 78.2% 84.5% V5 (many diffs) n/a
Download CSV